Nancy carole

HERE.

Thi

Lan Phuong Nguyen 4

777982

Contents
I. Abstract ……………………………………………………………………………………………………………………………… 3

II. Introduction ………………………………………………………………………………………………………………………. 3

2.1. Plant – microbial interaction ………………………………………………………………………………………….. 4

2.2 Lectin protein ……………………………………………………………………………………………………………….. 5

2.3. Arabidopsis plant …………………………………………………………………………………………………………. 8

2.4. Metagenomics …………………………………………………………………………………………………………….. 9

III. Research objective …………………………………………………………………………………………………………… 10

IV. Material and methods ……………………………………………………………………………………………………… 11

4.1. Plant growth conditions, chemical treatment and rhizosphere soil sampling …………………….. 11

4.1.1. Germinating Arabidopsis thaliana seeds …………………………………………………………………….. 11

4.1.1.1. Germinating Arabidopsis thaliana seeds on soil ………………………………………………………… 12

4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions …………………………………… 13

4.1.1.3. Checking homozygous seeds ………………………………………………………………………………….. 15

4.1.2. Preparation of E.coli for inoculation around plant roots ……………………………………………….. 16

4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate ………………………………………………………. 16

4.1.2.2. Growth of E.coli on LB Broth. ………………………………………………………………………………….. 16

4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of E.coli ………………….. 16

4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data processing. ………… 17

4.2.1. Plant genomic DNA and RNA extraction. …………………………………………………………………….. 17

4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium Bromide) ……………. 17

4.2.1.2. Plant RNA extraction. …………………………………………………………………………………………….. 19

4.2.2. Bacterial genomic DNA extraction. …………………………………………………………………………….. 20

4.2.4. Measure DNA concentration and checking the quality of DNA. …………………………………….. 23

4.2.4.1. Quantification of DNA concentration ………………………………………………………………………. 23

4.2.4.2. DNA quality confirmation ………………………………………………………………………………………. 24

4.2.5. DNA amplification by PCR (Polymerase Chain Reaction). ………………………………………………. 25

4.2.6. Clean up PCR products ……………………………………………………………………………………………… 25

4.2.8. Quantitative RT – PCR (qRT-PCR) ……………………………………………………………………………….. 27

V. Results …………………………………………………………………………………………………………………………….. 28

5.1. Screening and selecting homozygous lectin-1-overexpressing Arabidopsis plants ………………. 29

5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta herbicide. …………………… 29

5.1.2. Measurements of RNA concentrations from Arabidopsis plants ……………………………………. 31

Thi Lan Phuong Nguyen 42777982

5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR ………………………………………………… 32

5.2. Evaluation of survival bacteria around Lectin-1–overexpressing Arabidopsis thaliana. ……….. 33

5.2.1. Quantify the concentration of DNA extracted from root and rhizosphere ………………………. 34

5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers. ……………………………….. 35

5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers (906F and 1062R) ……. 36

VI. Discussion ………………………………………………………………………………………………………………………. 36

VII. Conclusion ……………………………………………………………………………………………………………………… 38

Thi Lan Phuong Nguyen 42777982

I. Abstract

The rhizosphere soil is an environment where different plant-microbe interactions occur.

Beside beneficial interactions that result in plant growth promotion or disease resistance,

plants also usually face a variety of pathogen and diseases. The protein Lectin belongs to a

group of carbohydrate-binding proteins and can be synthesized in various organs,

particularly in roots, tubers and seeds [1]. This protein plays a role in the recognition of

rhizobia by legume plant species and is related to different pathogen defence activities. This

research using lectin-1-overexpressing Arabidopsis thaliana was undertaken to investigate

whether lectins had ability to increase or decrease populations of rhizoshere bacteria. An

experiment for checking if the lectin-1-overexpressing transgenic line is homozygous was

also initially performed.

II. Introduction
Activities of microbial communities are key elements to determine biogeochemical

transformations in nature. They, therefore, can play an important role in managing and

engineering ecosystems [2]. The soil environment influenced by root is called rhizosphere. It

harbours the microbial diversity that affects plant health and nutrient [3]. However, the

mechanisms underlying these plant-microbe interactions are currently not well understood.

Improving methods to perform the whole community level characterisation of microbe

genome as well as the gene expression is an essential task which facilitates a comprehensive

profiling of rhizosphere communities [4].

Thi Lan Phuong Nguyen 42777982

2.1. Plant – microbial interaction

Plants and microorganisms become involved in a close interaction in soil environments. In

such relationships, it can be seen that plants play a role as a part of the microbial residence

environment and provide nutrient released from exudates as a substrate for microbe

growth, and microorganisms probably interact directly with plants via altering their

environment. For instance, saprophytic fungi play a role in decomposing complex organic

compounds and consequently plants can acquire readily available nutrients [5] [6]. On the

other hand, production of organic acids and/or proton extrusion can lead to a drop in pH in

soils. This change results in solubilisation of phosphate from precipitate form into the soil

solution and subsequently phosphate becomes available for plant uptake [6]. In addition,

locating with a large number in soil environment, once microbe die, the carcasses become

also a source of nutrient for plants. Bacterial rhizosphere microflora is also related to plant

health as it plays an important role in suppression soil borne plant diseases relied [7]. The

processes associated with such suppression that are involved in systemic acquired

resistance (SAR) or induced systemic resistance (ISR) could be antibiosis, lytic activity,

competition for substrates, or competition for iron caused by siderophores [7, 8]. In regard

to self-defence, due to the sessile lifestyle that consequently leads to the invasion of more

pathogen than other mobile eukaryotes, plants tend to secrete a wide range of chemical

defences against biological attacks. They can be antibiotics, or antibiotic precursors that

collectively called phytoanticipins [9]. Some of the best known group of phytoanticipins are

the saponins, steroid and terpenoid glycosides [10]. When the antibiotics are absent or

present with a very low concentration, phytoanticipins can be performed secondary

metabolites with antimicrobial activity [11]. Hence, it can be said that the characteristics of

plants as well as exudates released by roots definitely play the role in shaping the

composition of rhizosphere microbial community [12, 13]. It is also obvious that

maintenance of plant defences is costly. As a result, the mechanisms utilised by plants that

determine allocation of resources to defence microbial threats or growth have been

attracting scientists’ interest.

The major endogenous low molecular weight signal molecules involving in regulating the

plant defence signaling are the plant hormones salicylic acid (SA), jasmonic acid (JA),

ethylene (ET), and abscisic acid (ABA) [14, 15]. These hormones activate specific pathways

and can act individually, antagonistically or synergistically depending on the pathogen

Thi Lan Phuong Nguyen 42777982

involved [15]. In addition to local resistance, many of these phytohormones can also induce

defence responses in systemic tissues. An example is the ISR, which is triggered upon root

colonization by some non-pathogenic rhizobacteria. Meanwhile, SAR is induced in distal

tissues upon pathogen infection and generates a long-lasting resistance to secondary

infections caused by a broad spectrum of pathogens [15]. Furthermore, ISR is triggered by

application of methyl jasmonate while salicylic acid is an important phenolic compound for

establishment of SAR. Using Arabidopsis thaliana as a model plant, a complex interplay of

signal molecules in various defence-signaling pathways could be determined. Of them, JA is

a key member in the jasmonate family that plays a role in regulating plant defence to both

biotic and abiotic stresses. As other signalling pathways, the JA pathway includes the

perception of stress stimulus leading to local and systemic signal transduction, perception of

specific signal, followed by synthesis of jasmonic acid, and subsequently, responsiveness to

JA involving induction of subsequent downstream effects [15]. A study involving JA-

biosynthesis mutants showed that the triple mutant fad3 fad7 fad8 is deficient in the JA-

precursor leading to an inability in accumulating JA and consequently higher susceptibility to

infection by insect larvae [16]. Further experiments showed that the fad3 fad7 fad8 mutant

line is hypersusceptible to root rot caused by Pythium mastophorum. Alternatively, an

exogenous application of methyl jasmonic acid confers less susceptibility to soil-borne

pathogens [17]. Thus, both production of JA in wounded tissues as well as perception of JA

in distal tissues are vital for activation of systemic responses. In other words, JA molecules

function as a signal of ISR [18].

It can be seen that plant and microbe are involved in a consistent interaction that play a

vital role in natural balance in an ecosystem. In which, a numerous beneficial

microorganisms even have been described for plants. However, negative impacts of

soilborne bacteria is also considerable [19, 20]. Hence, studies of increasing the ability of

defending against plant pathogens need to be attentions for further researches.

2.2 Lectin protein

Lectins are carbohydrate-binding proteins that reversibly bind to specific mono or

oligosaccharides with high affinity [21]. Such proteins have been found in plants, animals

and microorganisms and are widely implicated in immune responses as pharmaceuticals

[20]. Lectins from about 80 species have been characterized to identify structures and

Thi Lan Phuong Nguyen 42777982

specific biological functions. Lectin-like proteins work as plant agglutinins and are involved

in plant’s defence against variety of plant-eating organisms [21]. They can be found in

different parts of various plants such as legume, cereals (eg. rice, wheat), solanaceae (eg.

tomatoes, potatoes) and particularly in tissues or organs that need extra protection such as

seeds or storage organs. A possible reason for extra protection is that they are susceptible

to attack by foreign organisms including conventional parasites and predators [21]. Based

on the structure, lectins are classified into three major types, including merolectins,

hololectins, and chimerolectins [21]. Merolectins are single polypeptide and contain

exclusively one single carbohydrate-binding domain, for example Hevein from rubber tree

[22] or monomeric Man-binding proteins of orchids [21]. Meanwhile, hololectins include

two or more carbonhydrate – binding domains and such domains are either identical or very

homologous [21]. However, the majority of well-known lectins are chimerolectins which

contain one carbonhydrate-binding domain arrayed tandemly with other unrelated domain

which acts independently on such carbonhydrate-binding domain. The pathogen defence

activity of lectin varies depending on its familiarity with the environment. For instance,

lectins that work as ribosome inactivating protein type 2 (type 2 RIPs) belong to the lectin

major type of chimerolectins and are extremely toxic to all eukaryotes when they reach the

cytoplasm [21]. There isevidence that type 2 RIPs which critically affect on higher animals

involving humans have been found since ancient times [21]. One kind of type 2 RIPs called

Ricin exhibits toxicity to the coleoptera Callosobruchus maculates and Anthonomus grandis

[23]. Another lectin which comes from winter aconite (Eranthis hyemalis) is highly toxic to

the larvae of the insect Diabrotica undecimpunctata, which is known to attack maize) [24].

Though type 2 RIPs are also toxic to fungi, deleterious effects due to invasion are normally

prevented since the presence of a rigid and thick cell wall. As a result, type 2 RIPs cannot

penetrate the cytoplast [21]. Although the evidence of antiviral activity of plant lectin is not

obvious, some plants expose indirectly antiviral action. For example the existence of

insecticidal lectin results in preventing or decreasing the spread of insect-transmitted viral

diseases. Meanwhile, the understanding about antibacterial activity of plant lectin seems to

be more convincing. In a research in 1977, Sequeira and Graham showed that potato lectins

that exist as cell wall proteins have the ability to immobilize avirulent strains of

Pseudomonas solanacearum when they attack the cell wall [25]. Because of the presence of

Thi Lan Phuong Nguyen 42777982

cytoplast, the mechanism of plant’s defence against bacteria must be indirect through

interactions of the protein lectin with extracellular glycans or carbonhydrates exposed on

the cell wall. Another example of such indirect defence is the interaction of thorn apple

(Datura stramonium) seed lectin with normal motile bacterial community around the air-

water interface resulting in blocking the movement of such bacteria [21]. The lectin-

mediated block of bacterial motility in the experiment expressed correlatively with the

highly specific release of lectin from the seed coat and the seed epidermis during

imbibitions [21]. Thus, by suppressing the chemotactic motility of soil bacteria toward

germinating seed, the protein lectin can protect seedling roots from harmful bacteria [21].

Brieftly, it can be concluded that most plant lectins are reported to be involved in plant

defences. From this viewpoint, the preferential accumulation of lectins in storage organs

has been the focus of attention for further research. Furthermore, lectins in plants are

typically present in large amounts and therefore also behave as storage proteins, as

plants

can accumulate them as a nitrogen reserve [21]. Recently, by using microarray screening

and a subtractive cDNA library from Alternaria brassicicola-inoculated Arabidopsis thaliana

plants, Prof Schenk’s research team discovered a gene (At3g15356) that encoded a lectin-

like protein [20]. The gene was named Protectin 1 and particularly responds to methyl

jasmonate signal and is up-regulated by all common plant defence pathways as well as by

the attack of pathogens and nematodes [20, 26]. Protectin 1 gene expresses one of the most

abundant transcripts during defence response against pathogen. Quantitative real-time PCR

(qRT-PCR) revealed an increase of 10% in gene expression of Protectin 1 when Arabidopsis

plants were exogenously treated with methyl jasmonate. Furthermore, the increase in

Lectin expression was also observed in treatments that included other defencedefence

signaling hormones, such as ethylene (ET) and salicylic acid (SA) (up to 13.1-fold and 11.1-

fold, respectively) [20]. However, such gene was suppressed by the compound abscisic acid

(ABA), which is a stress signaling compound. A clear repression of 5.6-fold of Protectin in

Arabidopsis was revealed after a 24-hour treatment with ABA [14]. Utilizing SDS-PAGE and

mass spectrometry, P. Schenk et al. envisaged two isoforms of Protectin-1, an

unglycosylated (29.989 kDa) and a heavily glycosylated (31.175 kDa) protein. The fully-

formed glycosylate harbours six or seven sugar residues binding to protein while the hypo-

glycosylated form consisted of just one sugar residue attached [20]. Plant expression studies

Thi Lan Phuong Nguyen 42777982

with fusion proteins that accumulate a green fluorescent protein (GFP) indicated that the

protein Protectin 1 is expressed in the root cell wall and may be able to act as a defence

barrier to the plant [20]. Lectin-overexpressing plants showed higher resistance against

bacteria possibly by immobilising them at the root surface. The present study aimed to

investigate whether the same mechanism of immobilising bacteria may also enable plants to

obtain nutrients by direct uptake of bacteria.

2.3. Arabidopsis plant

Since the research time is short, we used Arabidopsis thaliana which has a short life cycle. In

addition, Arabidopsis thaliana is an excellent model for investigating plant biotechnology

[27]. Although it has no major agronomic significance, Arabidopsis facilitates basic research

in genetics and molecular biology because these plants harbour a simple genome, short life

time, and a large number of mutant lines and genomic resources [28]. As rhizosphere and

plant roots are colonised by soil bacteria that are attracted by rhizodeposits, roots possibly

manipulate the microbial flora when they need to allocate resources for plant defence [29,

30]. Results shown by Hein et al. (2008) indicated that the diversity of rhizosphere microbes

is different between Arabidopsis thaliana salicylic acid-mediated systemic resistance mutant

and the wild-type. This insight opened the door towards a thorough understanding as well

as application of inducible plant as a control force in shaping soil bacterial assemblages [31].

As a first step to gain a further understanding about how Arabidopsis thaliana can

manipulate their soil environment via inducible defence mechanism, we attempted to

quantify Escherichia coli cells in the rhizosphere and roots of a lectin over-expressing line

and wild-type Arabidopsis thaliana. In nature, the Lectin gene is expressed in some plant

species including the wild-type Arabidopsis. A Lectin over-expressing line was generated by

transforming Arabidopsis plants with the 35S overexpressing promoter upstream the Lectin-

encoding gene. [26]. In order to facilitate the convenient selection of successful transgenic

plants, an anti-herbicide gene was inserted to the synthetic vector simultaneously.

Therefore, before conducting a germinating experiment, a step of checking homozygous

lectin-overexpressing Arabidopsis plants was performed by spraying basta, an herbicide that

Thi Lan Phuong Nguyen 42777982

should select for transgenic plants co-expressing the basta-resistance (BAR) gene. A 100%

survival rate indicated that mother plants are homozygous [32]. The 35S lectin

overexpression line at the 2
nd

day and the 5
th

day of post infection showed a lower amount

of bacteria Pseudomonas expression compared to the T-DNA/knock out line and the wild

type. Furthermore, less nematode eggs were also found in the rhizosphere of lectin

overexpressing plants in comparison to wild type. Surprisingly, none of these independent

overexpressing transgenic lines showed any discernible morphological phenotype [20].

2.4. Metagenomics

Metagenomics is the culture-independent genomic analysis to study potential functions of

microbial communities directly from their natural environments [33]. This term is combined

between the statistical concept of meta-analysis (a process of statistically combining

separate analyses) with genomics (the comprehensive acknowledge of an organism’s

genetic material) [34].

The soil microbial community is considered to have a highest level of microbial diversity

compared with other environments [35, 36]. The number of bacterial species per gram of

soil is estimated to vary between 2000 and 8.3 million [36]. This soil species pool confers a

gold-mine for genes servicing in applications in industry, such as pharmaceutical products as

well as in biodegradation of human-made pollutants [37, 38]. However, it is estimated that

only less than 1% of this diversity can be cultured by traditional techniques [39]. Thus,

culture-independent approaches including a variety of methods to extract DNA from soils

have been developed [40, 41] and if coupled to next generation sequencing, this approach

can significantly improve our access to these communities [35]. Metagenomics has recently

been advanced in microbial genomics, in polymerase chain reaction (PCR) amplification and

in cloning of genes that share a sequence which is similar to the 16S rRNA directly from

environmental samples [39]. In bacteria, archaea, chloroplasts, and mitochondria, a small

ribosomal subunit possesses the 16S rRNA (letter S in “16S” stands for Svedberg unit) while

the large one contains two rRNA species which are the 5S and 23S rRNAs. All of the bacterial

16S, 23S, and 5S rRNA genes are typically organized as a co-transcribed operon [42] and

generally, the rRNA genes are the most conserved (least variable) in all cells. So, portions of

the rDNA sequences from distantly-related organisms are very much alike and sequences

from such organisms can be precisely aligned. They generate the true differences for an

Thi Lan Phuong Nguyen 42777982

easy measurement. Consequently, the rRNA-coding genes are typically used to determine

taxonomy, evolutionary relationship, and the rate of species divergence among bacteria

[42]. Currently new deep sequencing methods confer a convenient platform to characterise

efficiently the composition of microbial communities [43, 44]. 16S rRNA pyrosequencing

that is used for quantification of bacteria presence recently has been become one of the

most striking means to tackle that issue. The 16S rRNA gene consists of highly conserved

regions which are interspersed with variable regions. Therefore, the PCR primers were

designed to be complementary to universally conserved regions and to flank variable

regions [45]. The results that are acquired from amplification and sequencing then are

compared to databases to allow the generation of bacterial lineages and proportions in their

community [46, 47]. Un-cultured rhizosphere bacteria have been also studied extensively

using 454/Roche pyrosequencing to identify the 16S rRNA gene sequence, and multiple

studies then have been conducted to optimise the method [45]. In briefly, this new and

potential technique can also become a powerful mean to evaluate the effect of plants to the

diversity of rhizophere bacteria.

III. Research objective
In this study we used the lectin-overexpressing Arabidopsis plants for controlled microbial

inoculation experiments. We aimed to quantify inoculated bacterial cells in the

rhizosphere

and roots and to explore whether inoculated bacteria may survive differently around lectin-

overexpressing plants. The following two objectives help to achieve the above-mentioned

aim.

Objective 1: Screening and isolating homozygous lectin-overexpressing Arabidopsis

plants.

Objective 2: Using controlled E. coli plant root inoculation experiments coupled with

quantitative PCR (qPCR) in order to evaluate the survival of these bacteria around lectin-

overexpressing plants. This may provide clues whether these plants can increase direct

nutrient uptake from bacteria.

Thi Lan Phuong Nguyen 42777982

IV.

Material and methods

Firstly, plants of Lectin-1-overexpressing Arabidopsis line were cultivated in soil. After 3

weeks when plants achieve 10-leaf-stage, Basta herbicide 1% was sprayed over plants. Since

the BAR gene for Basta resistance was co-transformed with the 35S promoter, survival rates

of plants after spraying were used to evaluate whether plants were offspring of homozygous

or heterozygous lines. The homozygous seeds that showed high percentages of germinating

and low rates of plants depicting any yellowing symptoms were chosen to be utilised in the

next screening step to isolate the best Lectin-1-overexpressing Arabidopsis plant. To

perform this screening, the best Lectin-1 seeds that were isolated from the Basta-spraying

experiment were germinated again and the plant tissues were collected for RNA extraction.

After cDNA synthesis, a qRT-PCR was performed utilising primers (provided by Shenk lab) to

amplify the Lec-1 gene to confirm which over-expressing line contained highest levels of Lec-

1 transcripts.

Other experiments later were carried out to determine differences of bacterial densities in

the rhizosphere of Arabidopsis between the wild type (WT) and the Lec-1 over-expressing

line. One was performed with surface sterilized seeds germinated on sterile solid medium of

Murashige and Skoog (MS) mineral salts. Seedlings were grown under axenic conditions.

After 2 weeks when these plants reached 6-8 leaf-stage, they were transferred to sterilised

vessels containing autoclaved soils and Escherichia coli was inoculated on the soil around

plants. E. coli was chosen since it does not form any kind of association with Arabidopsis

thaliana and is not ordinarily found in soils.

DNA then was extracted from roots and from the rhizosphere soil. qRT-PCR was performed

again using two sets of primers to amplify 16S rRNA gene.

4.1. Plant growth conditions, chemical treatment and rhizosphere soil

sampling

4.1.1. Germinating Arabidopsis thaliana seeds

Arabidopsis thaliana can be grown in various environment conditions, for instance, growth

chambers, growth rooms, window ledges, outdoors, or greenhouses [48]. Peat moss-based

mixes, defined agar media, relatively inert media watered with nutrient solutions and

commercial greenhouse mixes and can all be used as plant substrates [49]. However, this

Thi Lan Phuong Nguyen 42777982

study only focused on growth of plants on soil and on agar plates which are placed in

growth rooms. Arabidopsis seeds are typically stored at 4
o
C for three days after sowing.

4.1.1.1. Germinating Arabidopsis thaliana seeds on soil

In this study we used the product Real Premium Potting Mix manufactured by J.C. & A.T.

Searle Pty. Ltd, Queensland, Australia. The recipe contains Flourish soluble plant food,

Penetraide, Robust Plus, complete plant food plus trace elements, water crystals & zeolite,

and fully organic compost & peat.

Different containers or pots can be used for the growth of Arabidopsis plants on soil [49].

The preparation of pots and planting can be conducted as follows:

1. Potting soil was autoclaved first to give plants the best growing environment by killing

disease pathogens and weed seeds that might be lingered in soil. Typically, most

commercial products had been already done this step but it should be repeated again.

2. Several pots were placed in a tray or in another similar container which was covered by a

plastic wrap. Additionally, each pot was also covered by a piece of mesh fabric to keep the

soil inside as well as maintain enough humidity.

3. Humidified soil with tap water then place loosely soil in pots or flat chambers. The soil

was not compressed to give a soft and uniform bed. At this stage, pots were ready for

germinating.

4. Sowed Arabidopsis seed to the surface of soil pots. Try not to cover plant seeds by soil

since they needed light for germination.

5. Covered the trays by a clear plastics lid to maintain humidity for germination and avoid

seed desiccation.

6. The whole tray was covered more by a plastic bag and placed in the dark and cold room

at the refrigerator temperature (3-4°C) for 3 days to break dormancy and improve

germination rate and its synchrony. This treatment stage was especially important to freshly

harvested seeds that had more pronounced dormancy [49].

7. After the cold treatment stage, they were moved to the growth room and watered every

one or two days to maintain approximately 2 cm of water around seed during germination

phase.

Thi Lan Phuong Nguyen 42777982

Arabidopsis seedlings were grown in a growth chamber at 25°C with a photoperiod of 16

hour light and 8 hour dark. Under optimal conditions of water supply and good nutrition,

seeds started to germinate within 3-5 days [49].

After germination, plants were needed to avoid water stress. So, sub-irrigation was only

applied when the soil begin to dry. When plants had got true leaves, watering frequency

was decreased [49].

4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions

It is necessary to grow Arabidopsis thaliana axenically for this specific experiment of

determining the survival of bacteria around lectin-overexpressing plants compared to the

wild type. Firstly, we used petri dishes to germinate surface-sterilised seeds and then plants

were transferred to vessels containing soils.

 Germinating seed on agar plates

The media that was used for Arabidopsis culture was Murashige and Skoog (MS) mineral

salts added Bacto Agar TM 1.5% with optional 1.5% sucrose [49].

The recipe for 0.5L MS agar media:

– Sugar Sucrose 7.5g

– Agar 7.5g

– MS salt 1.1g

– Distilled water 500ml

Preparation of 500ml media

was conducted as follows:

– Added 7.5g of MS salts and 7.5g sugar to 450ml of distilled water, stired to dissolve;

– Checked and adjusted to pH 5.7. Adjustment was supported by 1M KOH;

– Added 7.5g agar and diluted with distilled water to final volume of 500mL;

– Autoclaved for 20 minutes at 121
o
C, 15 psi.

The solution was then divided into petri dishes and waited until the agar surface was hard

enough.

Seed sterilization was also required before using as follows:

1. Add ed1ml Ethanol 70% into tube of seed;

2. Vortexed or shaked for 2 minutes;

3. Poured away;

4. Added 1ml Bleach (Hypoclorit) 50%, , repeated every 1 minute in 10 minutes;

Thi Lan Phuong Nguyen 42777982

5. Washed at least 4 times with distilled water;

6. Added 1ml distilled water for using.

The stage of placing seeds on media plate was conducted in flow cabinet condition;

sterilized tips and pasteur pipet were also required. Otherwise, contamination can possibly

occur. Exhausted air from the pipet, soaked its tips into the seed tube and used slow release

pressure on bulb to take a single seed into tip. The seed then was dropped at the expected

location on agar surface. Try to design a fair density with about 64 seed per plate. These

seed plates were then covered and sealed with parafilm to prevent desiccation and

contamination and placed in the growth room under condition of 16 hour light and 8 hour

dark photoperiod. This photoperiodic lighting program stimulated the quick growth of

plants.

 Transfered plants from the agar plate to soil jars

The agar plate is a nice environment for Arabidopsis growth, however there is not enough

space for plant maturation. Thus, after 2 weeks when these plants got 6-8-leaf stage, they

were transferred to sterilize soil environment with E.coli inoculated in simultaneously as

shown in the figure 1 below. We used 7.5 cm-diameter clear transparent tissue culture jars.

Each one contains:

– University of California mix 25g

– Commercial compost soil 25g

These jars of soil blend then were undergone double sterilize treatment on the same day.

This soil mixture facilitated optimized water drainage for growth of Arabidopsis in tissue

culture jars. For treatment we applied to each jar: Plants taking out from agar plates were

grown into soil. The roots were buried well into medium soils before adding 1.2ml solution

of bacteria inoculation around each plant. Each of jars harboured 3 plants, so, 3.6ml

inoculation solution was added totally per container. Finally, 4.8ml of distilled water was

provided to ensure enough humidity for Arabidopsis growth. Closed tightly cap then placed

jars in growth environment. The environment inside jars currently liked a closed system.

Thi Lan Phuong Nguyen 42777982

Figure 1: Arabidopsis thaliana in the process of transferring form agar plate to soil

environment.

(A) Arabidopsis thaliana after two weeks of germination on the MS media

(B) Arabidopsis thaliana were grown in jar of soil

4.1.1.3. Checking homozygous seeds

In this research, the transgenic BAR gene against the herbicide BASTA was investigated as a

physiological marker. Each of grown plant was progeny of an independently-derived lectin-

transformed line. Such lectin-transformed plants typically carried one T-DNA insertion

hemizygously at a single locus, since plants harbouring 2 independent in sertions were not

common. As a result, lectin transformants needed to be selected for homozygosity via Basta

resistance, self-pollinated, and harvested individually. Among lectin-transformed lines, we

found the homozygous ones by checking the resistance of them to 1% Basta

herbicide.

Prepare 1% Basta solution:

Basta herbicide: 150µL

Distilled water: 15mL

Thi Lan Phuong Nguyen 42777982

4.1.2. Preparation of E.coli for inoculation around plant roots

4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate

* Recipe for 1L LB medium without antibiotic:

– Bacto Tryptone 10 g

– Yeast extract 5 g

– NaCl 10 g

– Agar 15g

This medium was autoclaved on liquid cycle at 15 psi for 20 minutes; cooled to

approximately 55°C and poured into petri dishes. Let harden, and then the plates were

inverted and stored at +4°C in the dark room. These plates were used for 16 streaking with

E.coli then inoculated overnight at 37
o
C.

4.1.2.2. Growth of E.coli on LB Broth.

On the following day, these isolated bacteria continued to be inoculated in LB broth within 3

hours before being added into soil jars.

 Recipe for 1L LB Broth:

– Bacto Tryptone 10 g

– Yeast extract 5 g

– NaCl 10 g

For this inoculated treatment, we used 2 flasks of 250ml with 100ml of LB Broth inside. One

very full loop of E.coli was added into the media. After 3 hours of inoculation at 37
o
C in

shaking machine, the number of bacteria was possibly generated enough for the next

inoculation in rhizosphere Arabidopsis environment.

4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of

E.coli

PBS recipe (1L)

1. Dissolved the following in 800ml distilled water;

– 8g of NaCl

– 0.2g of KCl

– 1.44g of Na2HPO4

– 0.24g of KH2PO4

2. Adjusted pH to 7.4;

Thi Lan Phuong Nguyen 42777982

3. Added distilled H2O to the final volume 1L;

4. Autoclaved

The procedure was conducted as follows:

1. Divided 200ml LB inoculum into 5 tubes of 50ml;

2. Centrifuged;

3. Discarded suspension;

4. Added 30ml PBS into each tube;

5. Vortexed well;

6. Centrifuged again;

7. Discarded suspension;

8. Added 40ml PBS into each tube;

9. Vortexed well before using.

4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data

processing.

4.2.1. Plant genomic DNA and RNA extraction.

4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium

Bromide)

Essentially, the extraction requires any mechanical means that can break down cell wall and

cell membranes to allow access to nuclear material without damaging DNA. This method

which uses CTAB can give intact genomic DNA from plant tissues.

After harvesting plant leaf, liquid nitrogen was employed in initial grinding stage for

breaking down cell wall material while harmful cellular enzymes and chemical remained

inactivated. The tissues were ground sufficiently then resuspended in CTAB buffer. Soluble

proteins and other material were separated by mixing with chloroform and centrifugation

while insoluble particulates were removed through centrifugation to purify DNA. Such

nucleic acid were then precipitated from aqueous phase and washed thoroughly to remove

contaminating salts.

Material and methods

– CTAB buffer;

– Mortar and Pestle;

– Microfuge tubes;

http://en.wikipedia.org/wiki/Cetyl_trimethylammonium_bromide

Thi Lan Phuong Nguyen 42777982

– Microfuge;

– Liquid Nitrogen;

– 70 % Ethanol (ice cold);

– Absolute Ethanol (ice cold);

– 7.5 M Ammonium Acetate;

– 55
o
C water bath;

– Distilled water;

– Chloroform: Iso Amyl Alcohol (24:1);

– RNase (10mg/mL).

CTAB buffer 100ml

– 2.0 g CTAB (Hexadecyl trimethyl-ammonium bromide)

– 10.0 ml

1 M Tris pH 8.0

– 28.0 ml 5 M NaCl

– 4.0 ml 0.5 M EDTA pH 8.0 (EthylenediaminetetraAcetic acid Di-

sodium salt)

– 1 g PVP 40 (polyvinyl pyrrolidone (vinylpyrrolidine homopolymer)

Molecular weight 40,000)

– 40.0 ml H2O

Adjusted the solution to pH 5.0 with HCL and made up to 100 mL with H2O.

1 M Tris pH 8.0

Dissolved 121.1g of Tris base in 800 ml of H2O. pH was adjusted to 8.0 (by adding HCL). The

solution was allowed to cool down to room temperature before making the final

adjustments to the pH of 8.0. Added more distilled water to the final volume 1L then

sterilized by autoclaving.

Procedure

1. Ground 200 mg of tissue sample to a fine paste with approximately 500 μL CTAB

buffer; 1μL of GFP plasmid was also added at the same time to calculate the PCR efficiency

later.

2. Transfered all extract mixture to a microcentrifuge tube;

3. Incubated for about 15 min in a recirculating water bath at 55
o
C;

Thi Lan Phuong Nguyen 42777982

4. The CTAB/plant extract mixture was spin at 12000 g for 5 min to spin down cell

debris then the supernatant was transferred to fresh microfuge tubes;

5. To each tube 250 μL of Chloroform: Iso Amyl Alcohol (24:1) is added. The solution

was mixed by inversion then spun at 13000 rpm for 1 min. The upper aqueous phase was

transferred to a clean microfuge tube. This stage was repeated twice;

6. 50 μL of 7.5 M Ammonium Acetate was added to each tube before adding 500 μL of

ice cold absolute ethanol. These tubes were then incubated over night at -2

o
C;

7. After incubation, spined to form pellet at 13.2 x 1000g for 30 minutes. Discarded the

supernatant and the DNA pellet was washed by adding two changes of ice cold 70 %

ethanol;

8. The DNA pellet was then formed again by centrifugation at 12000 for 5 minutes;

9. The DNA was let to be dried at room temperature for 15 minutes and then

resuspended in 50 μL ultrapure water followed by adding 1 μL RNase (10 ng/mL) and

incubating at 37
o
C for 1 hour to remove RNA in the preparation;

10. The resuspended DNA was then incubated at 65
o

C for 20 minutes to destroy any

contaminated DNase and stored at 4
o

C until using.

4.2.1.2. Plant RNA extraction.

Total RNA from leaves were extracted by SV Total RNA isolation Kit (Promega). All the work

places and pipettes were decontaminated with the solution RNA AWAY (Invitrogen).

The RNA concentration was measured by spectrophotometer (NanoDrop® ND-1000). To

check the quality of the RNA, an agarose gel was run with ethidium bromide. The procedure

was conducted as follows:

1. Samples (leaves) harvesting was placed in centrifuge tube then put in liquid nitrogen

that employs in initial grinding stage. Abrasive sticks were used to break down cell wall and

cell membrane in about 30 seconds before the sample can be defrosted.

2. Added 175 μL SV RNA Lysis Buffer (already added BME) to tubes. Mix through by

inversion.

3. Added 350 μL SV RNA Dilution Buffer. Mix briefly by inverting 3 – 4 times.

4. Centrifuged for 10 minutes then transfered the clear lysate to a clear

microcentrifuge tube.

5. Applied 200 μL Ethanol 100% to clear lysate, mixed well by repeat pipetting.

Thi Lan Phuong Nguyen 42777982

6. Transfered the mixture to Spin Basket Assembly then centrifuged for 1 minute.

Eluate was discarded.

7. Added 600 μL SV RNA Wash Solution (already added ethanol) then centrifuged for 1

minute and discard eluate.

– Prepared DNase incubation mix as follows:

Solution Volume x Number of Preps = Total

Yellow Core

Buffer

MnCl2 0.09M

DNase I

40 μL

5 μL

The solution was mixed well by pipet.

– Added 50 μL of DNase mix to membrane. Incubate for 15 minutes at room temperature.

– Added 200 μL SV DNase Stop Solution (+ethanol) then centrifuged for 1 minute.

– Added 600 μL SV RNA Wash solution (+ethanol), centrifuged for 1 minute

– Added 250 μL SV RNA Wash solution (+ethanol), centrifuged for 2 minute, then transferred

the Spin Basket to Elution Tube.

– Finally, 30 μL of nuclease–free water was added to membrane and centrifuged for 1

minute for eluting RNA and tried to keep immediately in ice or store at –

o
C until using.

4.2.2. Bacterial genomic DNA extraction.

1. Bacteria E.coli was incubated in 5mL of LB Broth overnight.

2. Divided 1.5 mL of culture into microfuge tube then centrifuged for 2 minutes to form

pellet. The supernatant was discarded.

3. The pellet was resuspended in 567 μL TE Buffer by repeat pipetting. 30 μL of 10%

SDS (Sodium dodecyl sulphate) was added to break cell membrane and then 3 μL of

20mg/mL proteinase K was applied to destroy proteins. Mixed well and incubation was at

37
o
C for 1 hour

4. Added 100 μL of 5M NaCl and mixed thoroughly.

5. 80 μL of CTAB/NaCl solution was added to dissolve DNA. The tube was mixed

thoroughly and incubated at 65
o
C for 10 minutes.

Thi Lan Phuong Nguyen 42777982

6. An equal volume (about 0.7 – 0.8 mL) of chloroform/isoamyl alcohol was added then

mixed thoroughly to denature protein. Such mixture was spun for 4 to 5 minutes in

microcentrifuge.

7. The aqueous, viscous supernatant was transferred to a fresh microcentrifuge tube by

pipetting while the interface behind was left. An equal volume of

phenol/chloroform/isoamyl alcohol was added and extracted thoroughly before spinning in

microcentrifuge for 5 minutes.

8. Transferred the supernatant to a new tube. 0.6 mL isopropanol was added to

precipitate nucleic acid. The tube was shaked back and forth until a stringy white DNA

precipitate was invisible clearly. The precipitate can be pelleted by spinning briefly while the

supernatant was removed.

9. Used pipet without touching to the pellet in order to wash DNA with 70% ethanol

which helped to remove remaining CTAB and NaCl then spined for 5 minutes at room

temperature to repellet.

10. Removed the supernatant carefully then redissolved the pellet in 100 μL distilled

water. DNA quality was confirmed by running electrophoresis gel. The DNA band appeared

at the top while many other smaller bands perform at the bottom.

TBE buffer recipe (1L)

54 g Tris base

20 ml of 0.5M EDTA (pH 8.0)

27.5 g boric acid

Added more distilled water until the final volume 1L

Prepared CTAB/NaCl solution

1. Dissolve 4.1 g NaCl in 80 ml of water

2. Add slowly 10 g CTAB while heating (65°C) and stirring. This step takes more than 3

hours to dissolve completely CTAB.

3. Adjust to the final volume of 100 mL

4. Sterilize by filter or autoclave.

A range of dilutions of the E.coli 16S amplicon were prepared as templates to produce a

calibration curve in the real time PCR. This curve is used to calculate for determining the

number of copies of a template per gram of soil.

Thi Lan Phuong Nguyen 42777982

4.2.3. DNA extraction from soil samples

In this study, PowerSoil
®
DNA Isolation Kit (MO BIO) was used to extract DNA from soil

samples. After the extraction, the DNA concentration was measured by spectrophotometer

NanoDrop and Qubit. To check the DNA quality, an agarose gel was run with ethidium

bromide. The protocol provided by the manufacturer was followed:

1. Placed 0.5 grams of soil sample to the PowerBead Tubes provided. 1µL of GFP plasmid

was added immediately after adding soil to quantify efficiency of PCR performance.

2. Mixed gently by vortex 2 to 3 seconds.

3. 60 µL of Solution C1 (without precipitation) was added then vortexed briefly or inverted

several times. If Solution C1 is precipitated, heat solution to

o
C until dissolved before use.

4. PowerBead Tubes were vortexed at maximum speed for 10 minutes then centrifuged at

10,000 x g for 30 seconds at room temperature.

5. Transferred supernatant to a fresh 2 ml Collection Tube (provided). At this time, the

supernatant may still contain some soil particles but the volume was expected around 400

µL to 500 µL.

6. 250 µL of Solution C2 was added and vortexed for 5 seconds. Incubated for 5 minutes at

4
o
C.

7. Centrifuged the tubes for 1 minute at 10,000 x g at room temperature.

8. Avoiding the pellet, transfer up to 600 µL of supernatant to a clean 2 ml Collection Tube

(provided).

9. 200 µL of Solution C3 was added and briefly vortexed before a short incubation at 4
o
C for

minutes.

10. The tubes were centrifuged at room temperature for 1 minute at 10,000 x g.

11. Avoiding the pellet, transferred up to 750 µL of supernatant to a clean 2 ml Collection

Tube (provided).

12. Shaked to mix Solution C4 then added 1200 µL of such solution to the supernatant and

briefly vortexed for 5 seconds.

13. Loaded approximately 675 µL onto a Spin Filter then centrifuged at room temperature

for 1 minute at 10,000 x g. Discarded the flow through then repeated adding 675 µL

supernatant and repeated centrifugation. The remaining supernatant then was applied onto

Thi Lan Phuong Nguyen 42777982

the Spin Filter and centrifuged in the same way. A total of three loads for each sample

processed were required.

14. Added 500 µL of Solution C5 and centrifuged at 10,000 x g for 30 seconds at room

temperature. Discarded the flow through.

15. Centrifuged at room temperature for 1 minute at 10,000 x g.

16. Carefully transferred the spin filter to a fresh 2 ml Collection Tube (provided).

17. 100 µL of Solution C6 was added to centre of the white filter membrane then

centrifuged at 10,000 x g for 30 seconds at room temperature.

18. Discarded the Spin Filter. The DNA collected in the tube was then ready for downstream

applications or stored at –

o
C until use.

4.2.4. Measure DNA concentration and checking the quality of DNA.

4.2.4.1. Quantification of DNA concentration

* Measure DNA, RNA concentration using NanoDrop® ND-1000 Spectrophotometer

The method that was based on UV absorbance measurements of nucleic acids at 260nm is

most commonly used and it can quantify a wide range of sample concentration from 2

ng/μL to 15 μg/μL. The ratio absorbance 260/280 performed the purity of DNA and RNA. A

ratio of at least 1.8 or 2.0 was generally accepted as pure for DNA and RNA, respectively.

Otherwise, lower ratios in either case indicated the presence of protein, phenol or any other

contaminants that can absorb at around 280nm wave length.

* Measure DNA concentration using Invitrogen Qubit® 2.0 Fluorometer

For DNA performing quantitative real-time PCR (qPCR), a precise measurement of

concentration was required.

The procedure was conducted as follows:

1. Prepared two Assay tubes (provided) for standards and one tube for each of sample

2. Prepared Working solution based on the volume of sample

Solution Volume x Number of Preps = Total

Qubit
TM

Buffer
Qubit
TM

Reagent

199 μL

1 μL

3. Prepared Assay tubes follows below table:

Thi Lan Phuong Nguyen 42777982

Solution Standard Assay tubes Sample Assay tubes

Working Solution 190 μL 180 – 199 μL

Standard (provided) 10 μL –

Sample – 1 – 20 μL

Total volume in each tube 200 μL 200 μL

4. Did vortex for 2 – 3 seconds

5. Incubated the tubes at room temperature for 2 minutes.

6. Inserted standard tubes in Qubit® 2.0 Fluorometer to set new standard followed by

inserting sample tubes to read results, refered to instruction on the screen [27].

Figure 2: The flow chart of measuring DNA concentration by Qubit
TM

assay

4.2.4.2. DNA quality confirmation

1. Prepared a 1 % solution of agarose by melting 0.5 gram of agarose in 50 mL of 0.5x

TBE buffer in a microwave for approximately 2 minutes.

2. Cooled down for a 2 minutes before adding 2.5 μL Ethidium Bromide, mixed briefly.

3. Applied a comp to a supplied tray then transferred all agar solution including

Ethidium Bromide into.

4. Allowed the gel casted for a minimum of 20 minutes at room temperature.

Thi Lan Phuong Nguyen 42777982

5. Carefully removed the comb.

6. Loaded the following into separate wells:

+ 5 μL 1kb ladder

+ 2 μL DNA sample + 1 μL Loading dye

6. Run the gel for 40 min at 100 V, 400 AMP

7. Exposed the gel under UV light. The presence of a highly resolved high molecular

weight band performs good quality DNA, meanwhile, the presence of a smeared band

indicates DNA degradation.

4.2.5. DNA amplification by PCR (Polymerase Chain Reaction).

In PCR tube (25 μL recipe)

PCR buffer with MgCl2 2.5 µL

dNTPs mix 0.5 µL

Forward primers 0.5 µL

Reverse primers 0.5 µL

Taq DNA Polymerase 0.5 µL

DNA sample 0.5 µL

Total 25 µL

Thermo-cycles

94
o
C 5 minutes

94
o
C 20 seconds

54
o
C 30 seconds

72
o
C 30 seconds

72
o
C 5 minutes

However, in the PCR with E.coli template, the annealing temperature increased to 61.5
o
C

instead of 54
o
C as above.

4.2.6. Clean up PCR products

Quick PCR clean up system was applied for special downstream application of quantitative

real time PCR. The Wizard® SV Gel and PCR Clean-Up System of Promega can eliminates

unincorporated primers and excessed dNTPs and got 95% recovery PCR product. The

protocol was conducted as follows:

Cycle repeated 40 times

Thi Lan Phuong Nguyen 42777982

* Prepare PCR product

An equal volume of Membrane Binding Solution was added to the PCR amplification.

* Binding of DNA

– Applied a SV Minicolumn into a Collection tube.

-Transfered the prepared PCR product to the Minicolumn assembly then incubated for 1

minute at room temperature.

– Centrifuged at 16000 x g for 1 minute and discarded flowthrough then reinserted the

Minicolumn into the Collection tube.

* Washing

– Added 700 µL Membrane Wash Solution (+ethanol) to the Minicolumn. Centrifuge for 1

minute at 16000 x g. Discard the flowthrough then reinserted Minicolumn into Collection

tube. This step was repeated with 500 µL Membrane Wash Solution (+ethanol). The

Minicolumn was centrifuged for 5 minutes at 16000 x g.

– Emptied the Collection tube then centrifuged column assembly with the opened

microcentrifuge lid for 3 minutes for evaporation of residual ethanol.

* Elution

– Transfered carefully the Minicolumn to a fresh microcentrifuge tube.

– Added 20 µL of Nuclease-free water to Minicolumn. Incubated for 1 minute at room

temperature then centrifuged for 3 minutes at 16000 x g.

– Finally, discarded Minicolumn and stored DNA at 4
o
C or -20

o
C [50].

4.2.7. cDNA synthesis

cDNA synthesis that was performed after RNA extraction was typically served for

downstream applications like RT-PCR. The quantification of RNA concentration was required

and then the RNA needs to be adjusted to 2.5 µg/µL

Prepare Master Mix

5X First – Strand buffer 4 µL

SupperScript
TM

III RT (20 u/ µL) 0.5 µL

0.1 M DTT 1 µL

Total 5.5 µL

In 0.2 mL PCR tube:

Thi Lan Phuong Nguyen 42777982

Up to 2.5 µg total RNA and MilliQ water 13.2 µL

Oligo dT (for eukaryote only) 0.2 µL

10mM dNTPs 1 µL

Total 14.5 µL

– The tube was mixed and incubated at 70
o
C for 5 minutes then quenched on ice for 2

minutes.

– Added Master mix to the tube.

– Kept at room temperature for 5 – 10 minutes before transferring to PCR machine.

Thermo-cycle

55
o
C 60 minutes

70
o
C 15 minutes

4
o
C hold forever

4.2.8. Quantitative RT – PCR (qRT-PCR)

The qRT-PCR was performed by Applied Biosystems 7900HT Fast Real-Time PCR System that

combined 384-well plate compatibility in the building 68, The University of Queensland,

Australia.

Recipe for each well

Cyber Green 5 µL

Primer mix (Forward and Reverse primers) 1 µL

DNA template 4 µL

Total 10 µL

The DNA used were PCR products amplified by the corresponding primers summarised as

bellow:

Table1: Primers were used for qRT-PCR

Name Common name Sequence

At1g49240 Beta-actin 8 GAGGATAGCATGTGGAACTGAGAA

At5g09810 Beta-actin 7 GAGGAAGAGCATTCCCCTCGTA

At3g15356 (R) Lec 1 GACCAAACTTTTCTTTTTCCGACTAA

At3g15356 (F) Lec 1 ATGGAAAGTCAGAAAACAACCTCATATT

Thi Lan Phuong Nguyen 42777982

rtSGFP_A GFP GGCATGGCGGACTTGAAG

rtSGFP_B GFP CAATGAGTATCTTATCCACAAGATGG

iASK_R (at5g26751) α-Shaggy kinase CTTATCGGATTTCTCTATGTTTGGC [51]

iASK_F (at5g26751) α-Shaggy kinase GAGCTCCTGTTAATTTAACTTGTACATACC [51]

ER-F2 E.coli 16S AGAAGCTTGCTCTTTGCTGA [52]

ER-R2 E.coli 16S CTTTGGTCTTGCGACGTTAT [52]

906F Universal E.coli 16S AGAAGCTTGCTCTTTGCTGA [50]

1062R Universal E.coli 16S CTTTGGTCTTGCGACGTTAT [50]

Firstly, the primers were diluted to the final concentration 0.3 µM, except the universal

primer pair of 906F+1062R that were diluted to 2.5 µM. Then, a mix containing the SYBR

Green and primers for each couple is prepared as mentioned on the recipe above. Three

technical replicates were included during the experiment to account for pipetting errors.

The program used for the thermocycler

 94°C for 3 min

 94°C for 1 min

 60°C for 0.3 min

 72°C for 1 min

 72°C for 7 min

However, to qRT-PCR that was performed for universal primers, the annealing temperature

was reduced to 54°C as an optimal annealing temperature [50].

V. Results
In this project Lectin-1-overexpressing Arabidopsis plants were used to study plant-microbe

interactions. This is based on previous findings that the Lectin-1 protein binds to E. coli and

Pseudomonas syringae. Here we investigated whether rhizosphere bacteria are influenced

by the presence of lectin-1 that is transported and stored in root cell walls and exuded.

Previously, putative Lectin-1 transgenic T2 Arabidopsis plants were produced but plants did

not appear to be homozygous as spraying with Basta led seedlings to die.

Cycle repeated 25 times

Thi Lan Phuong Nguyen 42777982

5.1. Screening and selecting homozygous lectin-1-overexpressing

Arabidopsis plants

5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta

herbicide.

Lectin 1 Arabidopsis seeds were named as A1, A2, A3, A4, A5, A6, A7, A9, A10, A11 and were

germinated in separate wells in the same tray. One week later, some seeds begun sprouting

and after 13 days, seeds in all chambers sprouted. The table below shows germination rates

after 3 weeks.

Table2: The number of seed germinating

Overall, the seeds A2, A3, A5, A8, and A11 displayed the highest percentages of germination

with 59%, 26%, 70%, 55% and 70% respectively. However, seed A11 needed a longer time to

start germinating than other seeds.

Basta herbicide 1% was then used to select seeds that were homozygous (see methods).

Table 3 summarised plant survival rates after spraying.

Plant The number of germinated seeds

A1 20

A2 59

A3 26

A4 3

A5 70

A6 25

A7 13

A8 55

A9 13

A10 7

A11 70

Thi Lan Phuong Nguyen 42777982

Table 3: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta

after one week

Plant The percentage of surviving plants The percentage of become-yellow plants

A1 100% 35%

A2 100% 5%

A3 100% 3.8%

A4 100% 33.3%

A5 100% 2.8%

A6 100% 20%

A7 100% 7.6%

A8 100% 12.7%

A9 100% 7.6%

A10 100% 0

A11 100% 11.4%

Then Basta-spraying was repeated and the result observed after two weeks was showed in

table 4 and in figure 2:

Table 4: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta

after two weeks.

Plant The percentage of

surviving plants

The percentage of die

plants

The percentage of plants

with yellowing symptoms

A1 100% 0 35%

A2 100% 0 5%

A3 100% 0 3.8%

A4 66.67% 33.3% 0%

A5 98.6% 1.4% 2.8%

A6 100% 0 28%

A7 100% 0 15.38%

A8 100% 0 7.2%

A9 100% 0 7.6%

A10 100% 0 14.28

Thi Lan Phuong Nguyen 42777982

A11 100% 0 12.85%

Figure 3: Appearance of Lectin 1-overexpressing Arabidopsis to herbicide Basta

after two weeks.

Table 4 shows that 33.3% of plants of A4 died and this percentage can be similar to

percentage of hybridization between heterozygous plants. The results suggest that A4 seeds

belong to a heterozygous plant while all other seeds are likely to be the progeny of

homozygous plants and hence these seeds are also homozygous. Half of Lectin-1 transgenic

T2 Arabidopsis plants were chosen for the next experiments to determine whether Lectin-1

was overexpressed. The seed genotypes that presented the healthiest seedlings after the

Basta sprayings were selected. Therefore, seeds A2, A3, A5, A8 showed the lowest

percentages of plants with yellowing symptoms, namely 5%; 3.8%; 2.8% and 7.2%,

respectively. Although one out of 70 plants of A5 presented 1.4% death rate, the seed A5

was considered homozygous and plants A5 looked overall greener than other ones after

spraying Basta, excepted the die plant that looked much smaller than others. The reason for

the death appeared to source from other factors, such as that those plants could not

compete to others to get enough nutrients and water.

5.1.2. Measurements of RNA concentrations from Arabidopsis plants

The selected genotypes of Lectin1-overproducing lines A2, A3, A5, A8 and wild type (WT)

were then germinated. After 2 to 3 weeks when plants reached 8-10-leaf stage, shoots were

harvested for RNA extraction.

Thi Lan Phuong Nguyen 42777982

The concentrations of RNA extracted from shoots were determined with both NanoDrop®

ND-1000 Spectrophotometer and Qubit(Invitrogen) (Table 3).

Table 5: Concentration of RNA extracting from plants

Samples RNA concentration

measuring by

NanoDrop

(ng/µL)

Ratio

260/280

RNA concentration

measuring by Qubit (ng/µL)

WT1 970.7 2.01 1220

WT2 560.6 2.1 1450

WT3 611.5 2.04 828

A2-1 1458.5 2.13 2060

A2-2 865 2.02 1160

A2-3 1206 2.1 1000

A3-1 596 2.08 460

A3-2 716.6 2.11 516

A3-3 1018.3 2.0 594

A5-1 1113.8 2.12 1550

A5-2 1441.2 2.06 1640

A5-3 1111.1 2.05 1360

A8-1 891.7 2.01 1110

A8-2 1156.6 2.09 1330

A8-3 1523.2 2.08 2180

Overall, the RNA concentrations were rather high. Besides, the ratios of 260/280 from

measuring by NanoDrop® ND-1000 Spectrophotometer were within the acceptable range

(1.8-2.2). Therefore, these RNA samples were utilized for performing cDNA synthesis for

further use in the qRT-PCR to quantify the Lectin 1 gene expression in wild type and Lectin-

1-overexpressing Arabidopsis plants.

5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR

To quantify expression levels of the Lectin 1 gene expressed in Arabidopsis plants, two sets

of primers were used: One for the amplification of the Lectin transcripts and one for Actin

transcripts that played the role as a house keeping gene in Arabidopsis thaliana. Based on

the Ct values and PCR efficiency values from qRT-PCR, relative expression of Lectin 1 gene to

Actin gene was determined (Table 4, Figure 1).

Thi Lan Phuong Nguyen 42777982

Table 6: Expression of Lectin 1 gene in Arabidopsis plants

Plant WT A2 A3 A5 A8

Average Biol. Rep. 0.366661 1.921221 1.263823 1.98152 1.808364

Standard Deviation 0.147542 0.08641 0.590564 0.150101 0.078753

Standard Error 0.085183 0.049889 0.340962 0.086661 0.045468

T-test 9.49956.

-5

0.063117 0.000185 0.000117

Figure 4: Relative expression of Lectin gene to Actin gene

Compared to the wild type, expressions values of Lectin 1 gene with 1.921221; 1.263823;

1.98152; 1.808364 in A2, A3, A5 and A8 plants, respectively were much higher than the

expression of 0.366661 in the wild type. Of them, plants of A5 showed the highest

expression level relative to actin (1.98152, P < 0,05). Hence A5 was chosen as the best

Lectin-1-overexpressing Arabidopsis genotype in this study, and was used in the subsequent

experiments

5.2. Evaluation of survival bacteria around Lectin-1–overexpressing

Arabidopsis thaliana.

To determine whether Lectin affect bacterial densities the rhizosphere or roots, , two

experiments using qRT-PCR to amplify E.coli 16S rRNA gene were conducted., One utilised

the primer pairs of ER-F2 and ER-R2 [52]. The other utilised universal bacterial primers 906F

Thi Lan Phuong Nguyen 42777982

and 1062R. Besides, a set of primers that amplify the GFP gene as well as the α-Shaggy

kinase gene (iASK) gene were used for rhizosphere soil and root samples, respectively..

Additionally, a range of dilutions of the E.coli 16S amplicon were prepared as templates to

produce a calibration curve in the real time PCR. This curve is used to calculate for

determining the number of copies of a template per gram of soil.

5.2.1. Quantify the concentration of DNA extracted from root and

rhizosphere

Initially, DNA extractions from root sample and soil samples were carried out and the DNA

concentration was measured as below:

Table 7: Concentration of DNA extracted from rhizosphere

Samples DNA concentration

measuring by
NanoDrop (ng/µL)

Ratio 260/280 DNA concentration

measuring by Qubit

(ng/µL)

WT1 18.2 1.77 8.78

WT2 12.1 1.67 6.6.2

WT3 11.8 1.70 5.60

A5-1 15.7 1.67 8.78

A5-2 17.0 1.90 10.6

A5-3 15.2 1.56 8.06

Table 8: Concentration of DNA extracting from roots

Samples DNA concentration measuring

by NanoDrop (ng/µL)

Ratio 260/280 DNA concentration
measuring by Qubit (ng/µL)

WT1 774.8 1.83 77

WT2 1344.7 1.91 123

WT3 904.8 1.86 100

A5-1 809.7 1.78 83

A5-2 686.9 1.70 108

A5-3 532.9 1.69 68.8

Thi Lan Phuong Nguyen 42777982

Overall, the DNA extracted from rhizosphere showed quite low concentrations while the

ones from root samples provided much higher yields.

5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers.

CT values of amplifications of DNA templates extracted from rhizosphere could not be

determined with the E. coli-specific 16S primers ER-F2 and ER-R2 that were revealed as the

most optimal ones for PCR of E.coli templates [52]. However, CT values obtained for root

samples were acceptable; hence all calculations were applied only to root DNA templates.

The α-Shaggy kinase plant gene (iASK) was used to measure relative bacterial abundance.

E.coli 16S abundance relative to the plant gene is shown in table 9.

Table 9: Expression of E.coli 16S copies relative to iASK gene

Plants Average Standard deviation Standard Error T-test

WT 68.24825349 15.33935 8.85617566 0.986599

A5 68.42902612 7.660091 4.422555381 0.245585

Figure 5: Relative expression of E.coli 16S sequence to iASK gene

Our results indicate that there was no significant difference in the abundance of E.coli in the

roots of wild type and transgenic plants (P > 0.05). To determine whether the primers could

amplify mitochondria DNA, a control sample of uninoculated axenically grown-root DNA

templates was included in the qRT-PCR. . A high Ct value for this sample (around 30), as

1.0095

11.0095

21.0095

31.0095

41.0095

51.0095

61.0095

71.0095

81.0095

WT LEC

E
.

co
li

1
6

S
r

e
la

ti
v

e
t

o
r

o
o

t
iA

S
K

Thi Lan Phuong Nguyen 42777982

opposed to 18 from E. coli-inoculated plants indicated that mitochondrial DNA amplification

was negligible.

5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers

(906F and 1062R)

Similarly to the other set of primers, for the primer pair 906F and 1062R, most of the CT

values for rhizosphere samples were undetermined. Relative abundances of E.coli 16S

copies to α-Shaggy kinase gene are shown in Table 10 and Figure 4.

Table 10: Expression of E.coli 16S sequence relative to iASK gene

Plants Average Standard deviation Standard Error T-test

WT 52.84153 36.05396 50.98801 0.730192

A5 36.56266 7.009206 12.1403 0.967496

Figure 6: Relative expression of E.coli 16S sequence to iASK gene

Similarly to the other set of primers tested, our results indicated that there was no

significant difference in E. coli abundance between the Lectin-1-overexpressing Arabidopsis

and the wild-type.

VI. Discussion
Quantification of Lectin-1 gene expression by qRT-PCR enabled the selection of A5 as the

genotype with the highest expression.

0
10
20

60
70

100

WT LEC

U
n

v
e

rs
a

l
1

6
S

r
e

la
ti

v
e

t
o

i
A

S
K

Thi Lan Phuong Nguyen 42777982

Such proteins have the ability to bind specifically and reversibly to carbohydrates with high

affinity [21]. Thus, lectins present on the root hair and secreted can specifically bind to

certain bacteria and initiate symbioses. Although lectins are found in various plant organs,

they seem to play the most important role in root tissues. The concentration is particularly

higher on the tips of developing root hairs, and they have also been localized in root

precursor cells [1]. Base on this background, the initial hypothesis assumed that the number

of bacteria E.coli in Lectin-1-overexpressing plant might decrease compared to that one

around wild type plants. Additionally, the previous study of Xavier (2012) indicates that

lectins decreases the number of E.coli in the rhizosphere soil [53].

However, comparisons of E.coli abundance in roots of Lectin-1-overexpressing line and the

wild type revealed no difference, although using two independent primer sets, one specific

for 16S from E. coli and another universal for 16S from bacteria in general.

With regard to qRT-PCR with DNA template extracted from rhizosphere, most Ct values

were undetermined even when universal primers were used (906F, 1062R). Thus, results

from previous research which reported that lectins affect the number of rhizosphere

bacteria could not be confirmed. The possible reason for undetermined Ct values can be the

very low DNA template concentration (5.6 ng/µL). Since this amount was not enough to

amplify the DNA template, Ct values were most undetermined or very high (over 40). This

study used DNA extraction Kits with 0.5 gram of soil, instead of RNA extraction method that

used 4 gram of sample as in the previous research of Xavier [53], so the quality of DNA

extracted could be different. Besides, the transgenic line in that study was also different as it

was heterozygous.

Hence, although there is evidence indicating that the significant presence of protein lectin

into the root cell wall can support the defence barrier of plant [20], the interaction between

lectins and bacteria has been a question. The E.coli that were utilized in this study is not an

environmental bacterium and does not naturally interact with Arabidopsis thaliana [54].

Thus, in the next study, other bacteria should be used for the inoculation such as

Pseudomonas aeruginosa that present commonly in variety of environments, especially in

water and soil. In a study, Walker et al. (2004) reported that pathogenic P. aeruginosa

strains PAO1 and PA14 are capable to infect the roots of Arabidopsis thaliana in vitro and in

the soil, and are capable of causing plant mortality of 7 day-postinoculation [55]. So, further

Thi Lan Phuong Nguyen 42777982

study with these bacteria can generate clues to answer the question of whether the lectin

protein can be actually plays the role in plant pathogen defence.

In addition, other methods of DNA extraction should also be applied to get higher yields of

DNA from rhizosphere soil. However, it is highly recommend the use of homozygous lectin-

1-overexpressing Arabidopsis thaliana for such study and the longer time of bacteria

inoculation in rhizophore also can be also considered.

VII. Conclusion
This study has identified a homozygous line of lectin-1-overexpressing Arabidopsis thaliana.

Moreover, the best lectin-expression line was selected and can be used in downstream

studies.

This study indicated that after two weeks after E. coli inoculation of lectin-1-overexpressing

Arabidopsis thaliana, the number of bacteria E.coli in roots did not decrease compared to

the wild type. Hence, lectins from protein in Arabidopsis thaliana did not appear to

influence E.coli abundance in roots. Thus, further studies should be conducted with others,

particularly pathogen to confirm the role of lectin protein in pathogen resistance in plants.

Thi Lan Phuong Nguyen 42777982

References

1. Hirsch, A.M., Role of lectins (and rhizobial exopolysaccharides) in legume nodulation.
Current Opinion in Plant Biology 1999. 2: p. 320–326.

2. Konopka, A., What is microbial community ecology[quest]. ISME J, 2009. 3(11): p.

1223-1230.

3. Carvalhais, L.C., et al., Rhizosphere Metatranscriptomics: Challenges and

Opportunities, in Molecular Microbial Ecology of the Rhizosphere. 2013, John Wiley &
Sons, Inc. p. 1137-1144.

4. Carvalhais, L.C., et al., Application of metatranscriptomics to soil environments.

Journal of Microbiological Methods, 2012. 91(2): p. 246-251.

5. Andrews, M., S. Hodge, and J.A. Raven, Positive plant microbial interactions. Annals

of Applied Biology, 2010. 157(3): p. 317-320.

6. Schenk, P.M., L.C. Carvalhais, and K. Kazan, Unraveling plant–microbe interactions:

can multi-species transcriptomics help? Trends in Biotechnology, 2012. 30(3): p. 177-
184.

7. Doornbos, R.F., et al., Effects of Jasmonic Acid, Ethylene, and Salicylic Acid Signaling

on the Rhizosphere Bacterial Community of Arabidopsis thaliana. Molecular Plant-
Microbe Interactions, 2010. 24(4): p. 395-407.

8. Pieterse, C.M.J., et al., Signalling in Rhizobacteria-Induced Systemic Resistance in

Arabidopsis thaliana. Plant Biology, 2002. 4(5): p. 535-544.

9. Funnell, D.L., C.L. Schardl, and P. Bednarek, Plant Defence against Fungal Attack:

Biochemistry, in eLS. 2001, John Wiley & Sons, Ltd.

10. Armah, C.N., et al., The Membrane-Permeabilizing Effect of Avenacin A-1 Involves the

Reorganization of Bilayer Cholesterol. Biophysical Journal, 1999. 76(1): p. 281-290.

Thi Lan Phuong Nguyen 42777982

11. Cruz-Cruz, C., et al., Phytoanticipins from banana (Musa acuminata cv. Grande

Naine) plants, with antifungal activity against Mycosphaerella fijiensis, the causal
agent of black Sigatoka. European Journal of Plant Pathology, 2010. 126(4): p. 459-
463.

12. Carvalhais, L.C., et al., Activation of the Jasmonic Acid Plant Defence Pathway Alters

the Composition of Rhizosphere Bacterial Communities. PLoS ONE, 2013. 8(2): p.
e56457.

13. Rasmann, S. and A.A. Agrawal, In Defence of Roots: A Research Agenda for Studying

Plant Resistance to Belowground Herbivory. Plant Physiology, 2008. 146(3): p. 875-

880.

14. Jonathan P. Anderson, E.B., Peer M. Schenk, John M. Manners, Olivia J. Desmond,
Christina Ehlert, Donald J. Maclean, Paul R. Ebert, and Kemal Kazana., Antagonistic
Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways
Modulates Defence Gene Expression and Disease Resistance in Arabidopsis. The Plant
Cell, 2004. 16(12): p. 3460-3479.

15. Kachroo, A. and P. Kachroo, Salicylic Acid-, Jasmonic Acid- and Ethylenemediated

Regulation of Plant Defence Signaling, in Genetic Engineering, J. Setlow, Editor. 2007,
Springer US. p. 55-83.

16. McConn, M., et al., Jasmonate is essential for insect defence in Arabidopsis.

Proceedings of the National Academy of Sciences, 1997. 94(10): p. 5473-5477.

17. Vijayan, P., et al., A role for jasmonate in pathogen defence of Arabidopsis.

Proceedings of the National Academy of Sciences, 1998. 95(12): p. 7209-7214.

18. Li, C., et al., Resistance of Cultivated Tomato to Cell Content-Feeding Herbivores Is

Regulated by the Octadecanoid-Signaling Pathway. Plant Physiology, 2002. 130(1): p.
494-503.

19. Bouizgarne, B., Bacteria for Plant Growth Promotion and Disease Management, in

Bacteria in Agrobiology: Disease Management, D.K. Maheshwari, Editor. 2013,
Springer Berlin Heidelberg. p. 15-47.

20. Schenk, P., A lectin family in Arabidopsis is activated by multiple defence pathways

and confers resistance against nematodes and pathogenic bacteria, 2010, The
University of Queensland.

21. Damme, W.J.P.a.E.J.M.V., Lectins as PIant Defence Proteins. Plant Physiol., 1995. 109:

p. 347-352.

22. Parijs, J., et al., Hevein: an antifungal protein from rubber-tree (Hevea brasiliensis)

latex. Planta, 1991. 183(2): p. 258-264.

Thi Lan Phuong Nguyen 42777982

23. Czapla, T.H. and B.A. Lang, Effect of Plant Lectins on the Larval Development of

European Corn Borer (Lepidoptera: Pyralidae) and Southern Corn Rootworm
(Coleoptera: Chrysomelidae). Journal of Economic Entomology, 1990. 83(6): p. 2480-
2485.

24. Kumar MA, T.D., Neet KE, Owen WG, Peumans WJ, Rao AG., Characterization of the

lectin from the bulbs of Eranthis hyemalis (winter aconite) as an inhibitor of protein
synthesis. THE JOURNAL OF BIOLOGICAL CHEMISTRY, 1993. 268(33)(November 25):
p. 25176-2518.

25. L. Sequeira, T.L.G., Agglutination of avirulent strains of Pseudomonus solanacearum

by potato lectin. Physiol Plant Pathology 1977. 11(1) p. 43-54.

26. Maria Prihtamala Omega, S.T.-H., Peer Schenk and Bostjan Kobe, A highly abundant

lectin protein Arabidopsis thaliana confers resistance against pathogens. ANNALES
BOGORIENSES, 2008. 12(01).

27. Wahl, V., et al., Regulation of Flowering by Trehalose-6-Phosphate Signaling in

Arabidopsis thaliana. Science, 2013. 339(6120): p. 704-707.

28. Hancock, A.M., et al., Adaptation to Climate Across the Arabidopsis thaliana

Genome. Science, 2011. 334(6052): p. 83-86.

29. Lugtenberg, B. and F. Kamilova, Plant-Growth-Promoting Rhizobacteria. Annual

Review of Microbiology, 2009. 63(1): p. 541-556.

30. Dennis, P.G., A.J. Miller, and P.R. Hirsch, Are root exudates more important than

other sources of rhizodeposits in structuring rhizosphere bacterial communities?
FEMS Microbiology Ecology, 2010. 72(3): p. 313-327.

31. Hein, J., G. Wolfe, and K. Blee, Comparison of Rhizosphere Bacterial Communities in

Arabidopsis thaliana Mutants for Systemic Acquired Resistance. Microbial Ecology,
2008. 55(2): p. 333-343.

32. Harrison, S., et al., A rapid and robust method of identifying transformed Arabidopsis

thaliana seedlings following floral dip transformation. Plant Methods, 2006. 2(1): p.
19.

33. Ghazanfar, S., et al., Metagenomics and its application in soil microbial community

studies: biotechnological prospects. Journal of Animal & Plant Sciences, 2010. 6(2): p.
611-622.

34. Rondon, M.R., et al., Cloning the Soil Metagenome: a Strategy for Accessing the

Genetic and Functional Diversity of Uncultured Microorganisms. Applied and
Environmental Microbiology, 2000. 66(6): p. 2541-2547.

Thi Lan Phuong Nguyen 42777982

35. Delmont, T.O., et al., Accessing the Soil Metagenome for Studies of Microbial
Diversity. Applied and Environmental Microbiology, 2011. 77(4): p. 1315-1324.

36. Roesch, L., et al., Pyrosequencing enumerates and contrasts soil microbial diversity.

The ISME Journal, 2007. 1(4): p. 283-90.

37. van Elsas, J.D., et al., The metagenomics of disease-suppressive soils – experiences

from the METACONTROL project. Trends in Biotechnology, 2008. 26(11): p. 591-601.
38. Boubakri, H., et al., Development of metagenomic DNA shuffling for the construction

of a xenobiotic gene. Gene, 2006. 375(0): p. 87-94.

39. Schloss, P.D. and J. Handelsman, Biotechnological prospects from metagenomics.

Current Opinion in Biotechnology, 2003. 14(3): p. 303-310.

40. Demanèche, S., et al., Antibiotic-resistant soil bacteria in transgenic plant fields.

Proceedings of the National Academy of Sciences, 2008. 105(10): p. 3957-3962.

41. Courtois, S., et al., Recombinant environmental libraries provide access to microbial

diversity for drug discovery from natural products. Applied and Environmental
Microbiology, 2003. 69(1): p. 49-55.

42. Jordan, J.A., A.R. Butchko, and M. Beth Durso, Use of Pyrosequencing of 16S rRNA

Fragments to Differentiate between Bacteria Responsible for Neonatal Sepsis. The
Journal of Molecular Diagnostics, 2005. 7(1): p. 105-110.

43. Dethlefsen, L., et al., The Pervasive Effects of an Antibiotic on the Human Gut

Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biol, 2008. 6(11): p.
e280.

44. Huse, S.M., et al., Exploring Microbial Diversity and Taxonomy Using SSU rRNA

Hypervariable Tag Sequencing. PLoS Genet, 2008. 4(11): p. e1000255.

45. Gary D Wu, J.D.L., Christian Hoffmann, Ying-Yu Chen, Rob Knight, Kyle Bittinger,

Jennifer Hwang, Jun Chen, Ronald Berkowsky, Lisa Nessel, Hongzhe Li and Frederic D
Bushman, Sampling and pyrosequencing methods for characterizing bacterial
communities in the human gut using 16S sequence tags. BMC Microbiology, 2010. 10
(206).

46. Wang, Q., et al., Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences

into the New Bacterial Taxonomy. Applied and Environmental Microbiology, 2007.
73(16): p. 5261-5267.

47. Ludwig, W., et al., ARB: a software environment for sequence data. Nucleic acids

research, 2004. 32(4): p. 1363-1371.

Thi Lan Phuong Nguyen 42777982

48. Shani, E., et al., Gibberellins accumulate in the elongating endodermal cells of
Arabidopsis root. Proceedings of the National Academy of Sciences, 2013. 110(12): p.
4834-4839.

49. Center, A.B.R. Handling Arabidopsis plants and seeds 2009 [cited 2013 May 3th];

Available from: http://www.biosci.ohio-
state.edu/~plantbio/Facilities/abrc/handling.htm.

50. Bacchetti De Gregoris, T., et al., Improvement of phylum- and class-specific primers

for real-time PCR quantification of bacterial taxa. Journal of Microbiological
Methods, 2011. 86(3): p. 351-356.

51. Gachon, C. and P. Saindrenan, Real-time PCR monitoring of fungal development in

Arabidopsis thaliana infected by Alternaria brassicicola and Botrytis cinerea. Plant
Physiology and Biochemistry, 2004. 42(5): p. 367-371.

52. Dong Hyuck Lee, J.E.B., Jung Hee Lee, Jeong Sup Shin, In Seop Kim, Quantitative

Detection of Residual E. coli Host Cell DNA by Real-Time PCR. Journal of Microbiology
and Biotechnology, 2010 20(10): p. 1463-1470.

53. Xavier, D., The role of lectins in plant-microbe interactions 2011, The University of

Queensland.

54. Paungfoo-Lonhienne, C., et al., Turning the Table: Plants Consume Microbes as a

Source of Nutrients. PLoS ONE, 2010. 5(7): p. e11915.

55. Walker, T.S., et al., Pseudomonas aeruginosa-Plant Root Interactions. Pathogenicity,

Biofilm Formation, and Root Exudation. Plant Physiology, 2004. 134(1): p. 320-331.

http://www.biosci.ohio-state.edu/~plantbio/Facilities/abrc/handling.htm

Turn in your highest-quality paper
Get a qualified writer to help you with

“ Nancy carole ”

Get high-quality paper

NEW! AI matching with writer

Still stressed from student homework?

Get quality assistance from academic writers!

Order now