USA: +1(669)289-8683 
Sign in
hi
I need to write 2000 words for “mehods” for my paper for master class.
please see attached files below.
Dearwriter this is the method which I used and I attached to
u my friend master project report ,she had different project
but it will help u because we work in the same lab and we did
some similar technics.u can also look to here references and
use it
The method:
First of all I germinate Arabidopsis seeds in autoclaved soil, then keep watering the
plants until its flowering then I start preparing the Agrobacterium bacteria broth to
start dip the plant flowers in that broth by using floral dip method, after the dipping I
kept that plant in room temperature for 24 h then I but it back in 25C and keep
watering until full flowering then start drying that plant by stop watering them until
it’s become yellow then collect the seeds.
second : germinate the collected seeds (which I collected from last step and its
already treated with Lectin 2 gene): germinate the seeds in autoclaved soil and
watering it until day 15 start spray the plant with Basta(its chemical herbicide) and
after 4 days spray it again with basta ,then again 4 days and spry it for last time .after
that I choose the resistance leaves only (the green leaves only )it was 8 plant only
and transfer it to growth in new soil ,in 24 c
Third after a month when the plant leaves grow well, I extract RNA from the leaves
(8 RNA extract sample), then I measure the concentration of RNA by 2 methods, first
Nano drop, second the qubit kit
Fourth: Inoculate the plant with pseudomonas syringe, by using syringe on the leaves
and then direct after the inoculate I extract DNA from 3 leaves of each plant ,and
after 24 hours i extract DNA from other 3 leaves from each plant ,then I measure the
DNA concentration by using Nano drop technique ,after that I did real time PCR to
check gene expression ,
Fifth: I converted RNA sample to DNA sample then I did real time PCR.
Finally I repeated the steps above with canola gene.
1. Germinating Arabidopsis thaliana seeds on soil
2. Agrobacterium bacteria broth:
Preparing the bacteria need to :
LB liquid:
10 g tryptone
5g yeast extract
10 g NACL
Water
LB agar:
5g tryptone
2.5g yest extract
5g nacl
5g agar
Then autoclave all of LB agar and liquid
Then add 2 different antibiotics to LB agar:
1-100 ul of tet 15 mg/ml
2-100 ul of kan 50 mg/ml
Then devided the liquid to 4 party dishes ,next growth
Agrobacterium tumefaciens by using 16 strek way on the agar
plate.
Preparing LB proth:
5 ml of LB liquid which I already prepared above
5 ul of tet 15 mg/ml
5 ul of kan 50 mg/ml
Little of Agrobacterium which is growth already on the plate
above.
Then keep it 24 h in 28c
When its become cloudy I will take :
2 ml of this broth
+
200 ml of LB liquid
200 ul of tet 15 mg/ml
200 ul of kan 50 mg/ml
Then keep it for 24 h in 28c
Next: after 24 hours
Divided the broth into 4 50 ml tubes
Then measuring the concentration of this broth
Then centrifuges this 4 tubes after that throw the pure liquid of 4
tubes to flask(don’t need it ,I only need to the bacteria in the
bottom of 4 tubes)
Prepared the Sucrose:
5g of sucrose
200 ml water
Mix it then divided it into the 4 tubes ,which contain in the bottom
the bacteria
Then
Centrifuge the 4 tubes and next collect the broth of this 4 tubes
into clean flask and add 500 ul of Silwet 0.05% and start dipping
3. Floral dip method
4. Collect the seeds:
Harvest dry seeds from 25c after 8 days of last watering.
5. Germinate the collected seeds (which I collected from last step
and it’s already treated with Lectin 2 gene
6. Spray the plant with Basta(its chemical herbicide(
Basta keep the plant green, so I spray the plant with Basta for 4 times then check which
leaves has high resistance against Basta and does not become yellow.
I prepared Basta spray by add 50 ml of water and 100 ul of Basta
7. Choose the resistance leaves only (the green leaves only
I found 8 plant was green, I transfer them to keep grow in new soil
8. Extract RNA from the leaves
I used SV total RNA isolation system (Kit protocol)
9. Measure the concentration of RNA by 2 methods, first Nano drop,
second the Qubit kit
10. Preparing pseudomonas syringe
The same steps of preparing Agrobacterium above
11. Inoculate the plant with pseudomonas syringe
12. Extract DNA from leaves
(2 times) first time direct after inoculated and the second after 24 Hours of
Inoculated.
I used CTAB protocol
13. Measure the DNA concentration:
I used Nano drop
14. Real time PCR: (this primers which I used)
real time PCR using the iASK primers on all samples and the HRPZ
primers on all samples.
Primer name and Sequence
rt_iASK_at5g2675F
GAGCTCCTGTTAATTTAACTTGTACATACC
rt_iASK_at5g2675R CTTATCGGATTTCTCTATGTTTGGC
pst_HRPZ_A TACCAAGACCACCACCCGAC
pst_HRPZ_B GCAACAAGGTGATGCCAGTG
rt_at3g16530_F GCCTTCATCATAACCCCGGAA
rt_at3g16530_R AATTCGATAGCCAAGATGTGGTTC
Thi
Lan Phuong Nguyen 4
777982
1
Contents
I. Abstract ……………………………………………………………………………………………………………………………… 3
II. Introduction ………………………………………………………………………………………………………………………. 3
2.1. Plant – microbial interaction ………………………………………………………………………………………….. 4
2.2 Lectin protein ……………………………………………………………………………………………………………….. 5
2.3. Arabidopsis plant …………………………………………………………………………………………………………. 8
2.4. Metagenomics …………………………………………………………………………………………………………….. 9
III. Research objective …………………………………………………………………………………………………………… 10
IV. Material and methods ……………………………………………………………………………………………………… 11
4.1. Plant growth conditions, chemical treatment and rhizosphere soil sampling …………………….. 11
4.1.1. Germinating Arabidopsis thaliana seeds …………………………………………………………………….. 11
4.1.1.1. Germinating Arabidopsis thaliana seeds on soil ………………………………………………………… 12
4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions …………………………………… 13
4.1.1.3. Checking homozygous seeds ………………………………………………………………………………….. 15
4.1.2. Preparation of E.coli for inoculation around plant roots ……………………………………………….. 16
4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate ………………………………………………………. 16
4.1.2.2. Growth of E.coli on LB Broth. ………………………………………………………………………………….. 16
4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of E.coli ………………….. 16
4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data processing. ………… 17
4.2.1. Plant genomic DNA and RNA extraction. …………………………………………………………………….. 17
4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium Bromide) ……………. 17
4.2.1.2. Plant RNA extraction. …………………………………………………………………………………………….. 19
4.2.2. Bacterial genomic DNA extraction. …………………………………………………………………………….. 20
4.2.4. Measure DNA concentration and checking the quality of DNA. …………………………………….. 23
4.2.4.1. Quantification of DNA concentration ………………………………………………………………………. 23
4.2.4.2. DNA quality confirmation ………………………………………………………………………………………. 24
4.2.5. DNA amplification by PCR (Polymerase Chain Reaction). ………………………………………………. 25
4.2.6. Clean up PCR products ……………………………………………………………………………………………… 25
4.2.8. Quantitative RT – PCR (qRT-PCR) ……………………………………………………………………………….. 27
V. Results …………………………………………………………………………………………………………………………….. 28
5.1. Screening and selecting homozygous lectin-1-overexpressing Arabidopsis plants ………………. 29
5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta herbicide. …………………… 29
5.1.2. Measurements of RNA concentrations from Arabidopsis plants ……………………………………. 31
Thi Lan Phuong Nguyen 42777982
2
5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR ………………………………………………… 32
5.2. Evaluation of survival bacteria around Lectin-1–overexpressing Arabidopsis thaliana. ……….. 33
5.2.1. Quantify the concentration of DNA extracted from root and rhizosphere ………………………. 34
5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers. ……………………………….. 35
5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers (906F and 1062R) ……. 36
VI. Discussion ………………………………………………………………………………………………………………………. 36
VII. Conclusion ……………………………………………………………………………………………………………………… 38
Thi Lan Phuong Nguyen 42777982
3
I. Abstract
The rhizosphere soil is an environment where different plant-microbe interactions occur.
Beside beneficial interactions that result in plant growth promotion or disease resistance,
plants also usually face a variety of pathogen and diseases. The protein Lectin belongs to a
group of carbohydrate-binding proteins and can be synthesized in various organs,
particularly in roots, tubers and seeds [1]. This protein plays a role in the recognition of
rhizobia by legume plant species and is related to different pathogen defence activities. This
research using lectin-1-overexpressing Arabidopsis thaliana was undertaken to investigate
whether lectins had ability to increase or decrease populations of rhizoshere bacteria. An
experiment for checking if the lectin-1-overexpressing transgenic line is homozygous was
also initially performed.
II. Introduction
Activities of microbial communities are key elements to determine biogeochemical
transformations in nature. They, therefore, can play an important role in managing and
engineering ecosystems [2]. The soil environment influenced by root is called rhizosphere. It
harbours the microbial diversity that affects plant health and nutrient [3]. However, the
mechanisms underlying these plant-microbe interactions are currently not well understood.
Improving methods to perform the whole community level characterisation of microbe
genome as well as the gene expression is an essential task which facilitates a comprehensive
profiling of rhizosphere communities [4].
Thi Lan Phuong Nguyen 42777982
4
2.1. Plant – microbial interaction
Plants and microorganisms become involved in a close interaction in soil environments. In
such relationships, it can be seen that plants play a role as a part of the microbial residence
environment and provide nutrient released from exudates as a substrate for microbe
growth, and microorganisms probably interact directly with plants via altering their
environment. For instance, saprophytic fungi play a role in decomposing complex organic
compounds and consequently plants can acquire readily available nutrients [5] [6]. On the
other hand, production of organic acids and/or proton extrusion can lead to a drop in pH in
soils. This change results in solubilisation of phosphate from precipitate form into the soil
solution and subsequently phosphate becomes available for plant uptake [6]. In addition,
locating with a large number in soil environment, once microbe die, the carcasses become
also a source of nutrient for plants. Bacterial rhizosphere microflora is also related to plant
health as it plays an important role in suppression soil borne plant diseases relied [7]. The
processes associated with such suppression that are involved in systemic acquired
resistance (SAR) or induced systemic resistance (ISR) could be antibiosis, lytic activity,
competition for substrates, or competition for iron caused by siderophores [7, 8]. In regard
to self-defence, due to the sessile lifestyle that consequently leads to the invasion of more
pathogen than other mobile eukaryotes, plants tend to secrete a wide range of chemical
defences against biological attacks. They can be antibiotics, or antibiotic precursors that
collectively called phytoanticipins [9]. Some of the best known group of phytoanticipins are
the saponins, steroid and terpenoid glycosides [10]. When the antibiotics are absent or
present with a very low concentration, phytoanticipins can be performed secondary
metabolites with antimicrobial activity [11]. Hence, it can be said that the characteristics of
plants as well as exudates released by roots definitely play the role in shaping the
composition of rhizosphere microbial community [12, 13]. It is also obvious that
maintenance of plant defences is costly. As a result, the mechanisms utilised by plants that
determine allocation of resources to defence microbial threats or growth have been
attracting scientists’ interest.
The major endogenous low molecular weight signal molecules involving in regulating the
plant defence signaling are the plant hormones salicylic acid (SA), jasmonic acid (JA),
ethylene (ET), and abscisic acid (ABA) [14, 15]. These hormones activate specific pathways
and can act individually, antagonistically or synergistically depending on the pathogen
Thi Lan Phuong Nguyen 42777982
5
involved [15]. In addition to local resistance, many of these phytohormones can also induce
defence responses in systemic tissues. An example is the ISR, which is triggered upon root
colonization by some non-pathogenic rhizobacteria. Meanwhile, SAR is induced in distal
tissues upon pathogen infection and generates a long-lasting resistance to secondary
infections caused by a broad spectrum of pathogens [15]. Furthermore, ISR is triggered by
application of methyl jasmonate while salicylic acid is an important phenolic compound for
establishment of SAR. Using Arabidopsis thaliana as a model plant, a complex interplay of
signal molecules in various defence-signaling pathways could be determined. Of them, JA is
a key member in the jasmonate family that plays a role in regulating plant defence to both
biotic and abiotic stresses. As other signalling pathways, the JA pathway includes the
perception of stress stimulus leading to local and systemic signal transduction, perception of
specific signal, followed by synthesis of jasmonic acid, and subsequently, responsiveness to
JA involving induction of subsequent downstream effects [15]. A study involving JA-
biosynthesis mutants showed that the triple mutant fad3 fad7 fad8 is deficient in the JA-
precursor leading to an inability in accumulating JA and consequently higher susceptibility to
infection by insect larvae [16]. Further experiments showed that the fad3 fad7 fad8 mutant
line is hypersusceptible to root rot caused by Pythium mastophorum. Alternatively, an
exogenous application of methyl jasmonic acid confers less susceptibility to soil-borne
pathogens [17]. Thus, both production of JA in wounded tissues as well as perception of JA
in distal tissues are vital for activation of systemic responses. In other words, JA molecules
function as a signal of ISR [18].
It can be seen that plant and microbe are involved in a consistent interaction that play a
vital role in natural balance in an ecosystem. In which, a numerous beneficial
microorganisms even have been described for plants. However, negative impacts of
soilborne bacteria is also considerable [19, 20]. Hence, studies of increasing the ability of
defending against plant pathogens need to be attentions for further researches.
2.2 Lectin protein
Lectins are carbohydrate-binding proteins that reversibly bind to specific mono or
oligosaccharides with high affinity [21]. Such proteins have been found in plants, animals
and microorganisms and are widely implicated in immune responses as pharmaceuticals
[20]. Lectins from about 80 species have been characterized to identify structures and
Thi Lan Phuong Nguyen 42777982
6
specific biological functions. Lectin-like proteins work as plant agglutinins and are involved
in plant’s defence against variety of plant-eating organisms [21]. They can be found in
different parts of various plants such as legume, cereals (eg. rice, wheat), solanaceae (eg.
tomatoes, potatoes) and particularly in tissues or organs that need extra protection such as
seeds or storage organs. A possible reason for extra protection is that they are susceptible
to attack by foreign organisms including conventional parasites and predators [21]. Based
on the structure, lectins are classified into three major types, including merolectins,
hololectins, and chimerolectins [21]. Merolectins are single polypeptide and contain
exclusively one single carbohydrate-binding domain, for example Hevein from rubber tree
[22] or monomeric Man-binding proteins of orchids [21]. Meanwhile, hololectins include
two or more carbonhydrate – binding domains and such domains are either identical or very
homologous [21]. However, the majority of well-known lectins are chimerolectins which
contain one carbonhydrate-binding domain arrayed tandemly with other unrelated domain
which acts independently on such carbonhydrate-binding domain. The pathogen defence
activity of lectin varies depending on its familiarity with the environment. For instance,
lectins that work as ribosome inactivating protein type 2 (type 2 RIPs) belong to the lectin
major type of chimerolectins and are extremely toxic to all eukaryotes when they reach the
cytoplasm [21]. There isevidence that type 2 RIPs which critically affect on higher animals
involving humans have been found since ancient times [21]. One kind of type 2 RIPs called
Ricin exhibits toxicity to the coleoptera Callosobruchus maculates and Anthonomus grandis
[23]. Another lectin which comes from winter aconite (Eranthis hyemalis) is highly toxic to
the larvae of the insect Diabrotica undecimpunctata, which is known to attack maize) [24].
Though type 2 RIPs are also toxic to fungi, deleterious effects due to invasion are normally
prevented since the presence of a rigid and thick cell wall. As a result, type 2 RIPs cannot
penetrate the cytoplast [21]. Although the evidence of antiviral activity of plant lectin is not
obvious, some plants expose indirectly antiviral action. For example the existence of
insecticidal lectin results in preventing or decreasing the spread of insect-transmitted viral
diseases. Meanwhile, the understanding about antibacterial activity of plant lectin seems to
be more convincing. In a research in 1977, Sequeira and Graham showed that potato lectins
that exist as cell wall proteins have the ability to immobilize avirulent strains of
Pseudomonas solanacearum when they attack the cell wall [25]. Because of the presence of
Thi Lan Phuong Nguyen 42777982
7
cytoplast, the mechanism of plant’s defence against bacteria must be indirect through
interactions of the protein lectin with extracellular glycans or carbonhydrates exposed on
the cell wall. Another example of such indirect defence is the interaction of thorn apple
(Datura stramonium) seed lectin with normal motile bacterial community around the air-
water interface resulting in blocking the movement of such bacteria [21]. The lectin-
mediated block of bacterial motility in the experiment expressed correlatively with the
highly specific release of lectin from the seed coat and the seed epidermis during
imbibitions [21]. Thus, by suppressing the chemotactic motility of soil bacteria toward
germinating seed, the protein lectin can protect seedling roots from harmful bacteria [21].
Brieftly, it can be concluded that most plant lectins are reported to be involved in plant
defences. From this viewpoint, the preferential accumulation of lectins in storage organs
has been the focus of attention for further research. Furthermore, lectins in plants are
typically present in large amounts and therefore also behave as storage proteins, as
plants
can accumulate them as a nitrogen reserve [21]. Recently, by using microarray screening
and a subtractive cDNA library from Alternaria brassicicola-inoculated Arabidopsis thaliana
plants, Prof Schenk’s research team discovered a gene (At3g15356) that encoded a lectin-
like protein [20]. The gene was named Protectin 1 and particularly responds to methyl
jasmonate signal and is up-regulated by all common plant defence pathways as well as by
the attack of pathogens and nematodes [20, 26]. Protectin 1 gene expresses one of the most
abundant transcripts during defence response against pathogen. Quantitative real-time PCR
(qRT-PCR) revealed an increase of 10% in gene expression of Protectin 1 when Arabidopsis
plants were exogenously treated with methyl jasmonate. Furthermore, the increase in
Lectin expression was also observed in treatments that included other defencedefence
signaling hormones, such as ethylene (ET) and salicylic acid (SA) (up to 13.1-fold and 11.1-
fold, respectively) [20]. However, such gene was suppressed by the compound abscisic acid
(ABA), which is a stress signaling compound. A clear repression of 5.6-fold of Protectin in
Arabidopsis was revealed after a 24-hour treatment with ABA [14]. Utilizing SDS-PAGE and
mass spectrometry, P. Schenk et al. envisaged two isoforms of Protectin-1, an
unglycosylated (29.989 kDa) and a heavily glycosylated (31.175 kDa) protein. The fully-
formed glycosylate harbours six or seven sugar residues binding to protein while the hypo-
glycosylated form consisted of just one sugar residue attached [20]. Plant expression studies
Thi Lan Phuong Nguyen 42777982
8
with fusion proteins that accumulate a green fluorescent protein (GFP) indicated that the
protein Protectin 1 is expressed in the root cell wall and may be able to act as a defence
barrier to the plant [20]. Lectin-overexpressing plants showed higher resistance against
bacteria possibly by immobilising them at the root surface. The present study aimed to
investigate whether the same mechanism of immobilising bacteria may also enable plants to
obtain nutrients by direct uptake of bacteria.
2.3. Arabidopsis plant
Since the research time is short, we used Arabidopsis thaliana which has a short life cycle. In
addition, Arabidopsis thaliana is an excellent model for investigating plant biotechnology
[27]. Although it has no major agronomic significance, Arabidopsis facilitates basic research
in genetics and molecular biology because these plants harbour a simple genome, short life
time, and a large number of mutant lines and genomic resources [28]. As rhizosphere and
plant roots are colonised by soil bacteria that are attracted by rhizodeposits, roots possibly
manipulate the microbial flora when they need to allocate resources for plant defence [29,
30]. Results shown by Hein et al. (2008) indicated that the diversity of rhizosphere microbes
is different between Arabidopsis thaliana salicylic acid-mediated systemic resistance mutant
and the wild-type. This insight opened the door towards a thorough understanding as well
as application of inducible plant as a control force in shaping soil bacterial assemblages [31].
As a first step to gain a further understanding about how Arabidopsis thaliana can
manipulate their soil environment via inducible defence mechanism, we attempted to
quantify Escherichia coli cells in the rhizosphere and roots of a lectin over-expressing line
and wild-type Arabidopsis thaliana. In nature, the Lectin gene is expressed in some plant
species including the wild-type Arabidopsis. A Lectin over-expressing line was generated by
transforming Arabidopsis plants with the 35S overexpressing promoter upstream the Lectin-
encoding gene. [26]. In order to facilitate the convenient selection of successful transgenic
plants, an anti-herbicide gene was inserted to the synthetic vector simultaneously.
Therefore, before conducting a germinating experiment, a step of checking homozygous
lectin-overexpressing Arabidopsis plants was performed by spraying basta, an herbicide that
Thi Lan Phuong Nguyen 42777982
9
should select for transgenic plants co-expressing the basta-resistance (BAR) gene. A 100%
survival rate indicated that mother plants are homozygous [32]. The 35S lectin
overexpression line at the 2
nd
day and the 5
th
day of post infection showed a lower amount
of bacteria Pseudomonas expression compared to the T-DNA/knock out line and the wild
type. Furthermore, less nematode eggs were also found in the rhizosphere of lectin
overexpressing plants in comparison to wild type. Surprisingly, none of these independent
overexpressing transgenic lines showed any discernible morphological phenotype [20].
2.4. Metagenomics
Metagenomics is the culture-independent genomic analysis to study potential functions of
microbial communities directly from their natural environments [33]. This term is combined
between the statistical concept of meta-analysis (a process of statistically combining
separate analyses) with genomics (the comprehensive acknowledge of an organism’s
genetic material) [34].
The soil microbial community is considered to have a highest level of microbial diversity
compared with other environments [35, 36]. The number of bacterial species per gram of
soil is estimated to vary between 2000 and 8.3 million [36]. This soil species pool confers a
gold-mine for genes servicing in applications in industry, such as pharmaceutical products as
well as in biodegradation of human-made pollutants [37, 38]. However, it is estimated that
only less than 1% of this diversity can be cultured by traditional techniques [39]. Thus,
culture-independent approaches including a variety of methods to extract DNA from soils
have been developed [40, 41] and if coupled to next generation sequencing, this approach
can significantly improve our access to these communities [35]. Metagenomics has recently
been advanced in microbial genomics, in polymerase chain reaction (PCR) amplification and
in cloning of genes that share a sequence which is similar to the 16S rRNA directly from
environmental samples [39]. In bacteria, archaea, chloroplasts, and mitochondria, a small
ribosomal subunit possesses the 16S rRNA (letter S in “16S” stands for Svedberg unit) while
the large one contains two rRNA species which are the 5S and 23S rRNAs. All of the bacterial
16S, 23S, and 5S rRNA genes are typically organized as a co-transcribed operon [42] and
generally, the rRNA genes are the most conserved (least variable) in all cells. So, portions of
the rDNA sequences from distantly-related organisms are very much alike and sequences
from such organisms can be precisely aligned. They generate the true differences for an
Thi Lan Phuong Nguyen 42777982
10
easy measurement. Consequently, the rRNA-coding genes are typically used to determine
taxonomy, evolutionary relationship, and the rate of species divergence among bacteria
[42]. Currently new deep sequencing methods confer a convenient platform to characterise
efficiently the composition of microbial communities [43, 44]. 16S rRNA pyrosequencing
that is used for quantification of bacteria presence recently has been become one of the
most striking means to tackle that issue. The 16S rRNA gene consists of highly conserved
regions which are interspersed with variable regions. Therefore, the PCR primers were
designed to be complementary to universally conserved regions and to flank variable
regions [45]. The results that are acquired from amplification and sequencing then are
compared to databases to allow the generation of bacterial lineages and proportions in their
community [46, 47]. Un-cultured rhizosphere bacteria have been also studied extensively
using 454/Roche pyrosequencing to identify the 16S rRNA gene sequence, and multiple
studies then have been conducted to optimise the method [45]. In briefly, this new and
potential technique can also become a powerful mean to evaluate the effect of plants to the
diversity of rhizophere bacteria.
III. Research objective
In this study we used the lectin-overexpressing Arabidopsis plants for controlled microbial
inoculation experiments. We aimed to quantify inoculated bacterial cells in the
rhizosphere
and roots and to explore whether inoculated bacteria may survive differently around lectin-
overexpressing plants. The following two objectives help to achieve the above-mentioned
aim.
Objective 1: Screening and isolating homozygous lectin-overexpressing Arabidopsis
plants.
Objective 2: Using controlled E. coli plant root inoculation experiments coupled with
quantitative PCR (qPCR) in order to evaluate the survival of these bacteria around lectin-
overexpressing plants. This may provide clues whether these plants can increase direct
nutrient uptake from bacteria.
Thi Lan Phuong Nguyen 42777982
11
IV.
Material and methods
Firstly, plants of Lectin-1-overexpressing Arabidopsis line were cultivated in soil. After 3
weeks when plants achieve 10-leaf-stage, Basta herbicide 1% was sprayed over plants. Since
the BAR gene for Basta resistance was co-transformed with the 35S promoter, survival rates
of plants after spraying were used to evaluate whether plants were offspring of homozygous
or heterozygous lines. The homozygous seeds that showed high percentages of germinating
and low rates of plants depicting any yellowing symptoms were chosen to be utilised in the
next screening step to isolate the best Lectin-1-overexpressing Arabidopsis plant. To
perform this screening, the best Lectin-1 seeds that were isolated from the Basta-spraying
experiment were germinated again and the plant tissues were collected for RNA extraction.
After cDNA synthesis, a qRT-PCR was performed utilising primers (provided by Shenk lab) to
amplify the Lec-1 gene to confirm which over-expressing line contained highest levels of Lec-
1 transcripts.
Other experiments later were carried out to determine differences of bacterial densities in
the rhizosphere of Arabidopsis between the wild type (WT) and the Lec-1 over-expressing
line. One was performed with surface sterilized seeds germinated on sterile solid medium of
Murashige and Skoog (MS) mineral salts. Seedlings were grown under axenic conditions.
After 2 weeks when these plants reached 6-8 leaf-stage, they were transferred to sterilised
vessels containing autoclaved soils and Escherichia coli was inoculated on the soil around
plants. E. coli was chosen since it does not form any kind of association with Arabidopsis
thaliana and is not ordinarily found in soils.
DNA then was extracted from roots and from the rhizosphere soil. qRT-PCR was performed
again using two sets of primers to amplify 16S rRNA gene.
4.1. Plant growth conditions, chemical treatment and rhizosphere soil
sampling
4.1.1. Germinating Arabidopsis thaliana seeds
Arabidopsis thaliana can be grown in various environment conditions, for instance, growth
chambers, growth rooms, window ledges, outdoors, or greenhouses [48]. Peat moss-based
mixes, defined agar media, relatively inert media watered with nutrient solutions and
commercial greenhouse mixes and can all be used as plant substrates [49]. However, this
Thi Lan Phuong Nguyen 42777982
12
study only focused on growth of plants on soil and on agar plates which are placed in
growth rooms. Arabidopsis seeds are typically stored at 4
o
C for three days after sowing.
4.1.1.1. Germinating Arabidopsis thaliana seeds on soil
In this study we used the product Real Premium Potting Mix manufactured by J.C. & A.T.
Searle Pty. Ltd, Queensland, Australia. The recipe contains Flourish soluble plant food,
Penetraide, Robust Plus, complete plant food plus trace elements, water crystals & zeolite,
and fully organic compost & peat.
Different containers or pots can be used for the growth of Arabidopsis plants on soil [49].
The preparation of pots and planting can be conducted as follows:
1. Potting soil was autoclaved first to give plants the best growing environment by killing
disease pathogens and weed seeds that might be lingered in soil. Typically, most
commercial products had been already done this step but it should be repeated again.
2. Several pots were placed in a tray or in another similar container which was covered by a
plastic wrap. Additionally, each pot was also covered by a piece of mesh fabric to keep the
soil inside as well as maintain enough humidity.
3. Humidified soil with tap water then place loosely soil in pots or flat chambers. The soil
was not compressed to give a soft and uniform bed. At this stage, pots were ready for
germinating.
4. Sowed Arabidopsis seed to the surface of soil pots. Try not to cover plant seeds by soil
since they needed light for germination.
5. Covered the trays by a clear plastics lid to maintain humidity for germination and avoid
seed desiccation.
6. The whole tray was covered more by a plastic bag and placed in the dark and cold room
at the refrigerator temperature (3-4°C) for 3 days to break dormancy and improve
germination rate and its synchrony. This treatment stage was especially important to freshly
harvested seeds that had more pronounced dormancy [49].
7. After the cold treatment stage, they were moved to the growth room and watered every
one or two days to maintain approximately 2 cm of water around seed during germination
phase.
Thi Lan Phuong Nguyen 42777982
13
Arabidopsis seedlings were grown in a growth chamber at 25°C with a photoperiod of 16
hour light and 8 hour dark. Under optimal conditions of water supply and good nutrition,
seeds started to germinate within 3-5 days [49].
After germination, plants were needed to avoid water stress. So, sub-irrigation was only
applied when the soil begin to dry. When plants had got true leaves, watering frequency
was decreased [49].
4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions
It is necessary to grow Arabidopsis thaliana axenically for this specific experiment of
determining the survival of bacteria around lectin-overexpressing plants compared to the
wild type. Firstly, we used petri dishes to germinate surface-sterilised seeds and then plants
were transferred to vessels containing soils.
Germinating seed on agar plates
The media that was used for Arabidopsis culture was Murashige and Skoog (MS) mineral
salts added Bacto Agar TM 1.5% with optional 1.5% sucrose [49].
The recipe for 0.5L MS agar media:
– Sugar Sucrose 7.5g
– Agar 7.5g
– MS salt 1.1g
– Distilled water 500ml
Preparation of 500ml media
was conducted as follows:
– Added 7.5g of MS salts and 7.5g sugar to 450ml of distilled water, stired to dissolve;
– Checked and adjusted to pH 5.7. Adjustment was supported by 1M KOH;
– Added 7.5g agar and diluted with distilled water to final volume of 500mL;
– Autoclaved for 20 minutes at 121
o
C, 15 psi.
The solution was then divided into petri dishes and waited until the agar surface was hard
enough.
Seed sterilization was also required before using as follows:
1. Add ed1ml Ethanol 70% into tube of seed;
2. Vortexed or shaked for 2 minutes;
3. Poured away;
4. Added 1ml Bleach (Hypoclorit) 50%, , repeated every 1 minute in 10 minutes;
Thi Lan Phuong Nguyen 42777982
14
5. Washed at least 4 times with distilled water;
6. Added 1ml distilled water for using.
The stage of placing seeds on media plate was conducted in flow cabinet condition;
sterilized tips and pasteur pipet were also required. Otherwise, contamination can possibly
occur. Exhausted air from the pipet, soaked its tips into the seed tube and used slow release
pressure on bulb to take a single seed into tip. The seed then was dropped at the expected
location on agar surface. Try to design a fair density with about 64 seed per plate. These
seed plates were then covered and sealed with parafilm to prevent desiccation and
contamination and placed in the growth room under condition of 16 hour light and 8 hour
dark photoperiod. This photoperiodic lighting program stimulated the quick growth of
plants.
Transfered plants from the agar plate to soil jars
The agar plate is a nice environment for Arabidopsis growth, however there is not enough
space for plant maturation. Thus, after 2 weeks when these plants got 6-8-leaf stage, they
were transferred to sterilize soil environment with E.coli inoculated in simultaneously as
shown in the figure 1 below. We used 7.5 cm-diameter clear transparent tissue culture jars.
Each one contains:
– University of California mix 25g
– Commercial compost soil 25g
These jars of soil blend then were undergone double sterilize treatment on the same day.
This soil mixture facilitated optimized water drainage for growth of Arabidopsis in tissue
culture jars. For treatment we applied to each jar: Plants taking out from agar plates were
grown into soil. The roots were buried well into medium soils before adding 1.2ml solution
of bacteria inoculation around each plant. Each of jars harboured 3 plants, so, 3.6ml
inoculation solution was added totally per container. Finally, 4.8ml of distilled water was
provided to ensure enough humidity for Arabidopsis growth. Closed tightly cap then placed
jars in growth environment. The environment inside jars currently liked a closed system.
Thi Lan Phuong Nguyen 42777982
15
Figure 1: Arabidopsis thaliana in the process of transferring form agar plate to soil
environment.
(A) Arabidopsis thaliana after two weeks of germination on the MS media
(B) Arabidopsis thaliana were grown in jar of soil
(C) Arabidopsis thaliana in jar of soil after two weeks
4.1.1.3. Checking homozygous seeds
In this research, the transgenic BAR gene against the herbicide BASTA was investigated as a
physiological marker. Each of grown plant was progeny of an independently-derived lectin-
transformed line. Such lectin-transformed plants typically carried one T-DNA insertion
hemizygously at a single locus, since plants harbouring 2 independent in sertions were not
common. As a result, lectin transformants needed to be selected for homozygosity via Basta
resistance, self-pollinated, and harvested individually. Among lectin-transformed lines, we
found the homozygous ones by checking the resistance of them to 1% Basta
herbicide.
Prepare 1% Basta solution:
Basta herbicide: 150µL
Distilled water: 15mL
Thi Lan Phuong Nguyen 42777982
16
4.1.2. Preparation of E.coli for inoculation around plant roots
4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate
* Recipe for 1L LB medium without antibiotic:
– Bacto Tryptone 10 g
– Yeast extract 5 g
– NaCl 10 g
– Agar 15g
This medium was autoclaved on liquid cycle at 15 psi for 20 minutes; cooled to
approximately 55°C and poured into petri dishes. Let harden, and then the plates were
inverted and stored at +4°C in the dark room. These plates were used for 16 streaking with
E.coli then inoculated overnight at 37
o
C.
4.1.2.2. Growth of E.coli on LB Broth.
On the following day, these isolated bacteria continued to be inoculated in LB broth within 3
hours before being added into soil jars.
Recipe for 1L LB Broth:
– Bacto Tryptone 10 g
– Yeast extract 5 g
– NaCl 10 g
For this inoculated treatment, we used 2 flasks of 250ml with 100ml of LB Broth inside. One
very full loop of E.coli was added into the media. After 3 hours of inoculation at 37
o
C in
shaking machine, the number of bacteria was possibly generated enough for the next
inoculation in rhizosphere Arabidopsis environment.
4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of
E.coli
PBS recipe (1L)
1. Dissolved the following in 800ml distilled water;
– 8g of NaCl
– 0.2g of KCl
– 1.44g of Na2HPO4
– 0.24g of KH2PO4
2. Adjusted pH to 7.4;
Thi Lan Phuong Nguyen 42777982
17
3. Added distilled H2O to the final volume 1L;
4. Autoclaved
The procedure was conducted as follows:
1. Divided 200ml LB inoculum into 5 tubes of 50ml;
2. Centrifuged;
3. Discarded suspension;
4. Added 30ml PBS into each tube;
5. Vortexed well;
6. Centrifuged again;
7. Discarded suspension;
8. Added 40ml PBS into each tube;
9. Vortexed well before using.
4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data
processing.
4.2.1. Plant genomic DNA and RNA extraction.
4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium
Bromide)
Essentially, the extraction requires any mechanical means that can break down cell wall and
cell membranes to allow access to nuclear material without damaging DNA. This method
which uses CTAB can give intact genomic DNA from plant tissues.
After harvesting plant leaf, liquid nitrogen was employed in initial grinding stage for
breaking down cell wall material while harmful cellular enzymes and chemical remained
inactivated. The tissues were ground sufficiently then resuspended in CTAB buffer. Soluble
proteins and other material were separated by mixing with chloroform and centrifugation
while insoluble particulates were removed through centrifugation to purify DNA. Such
nucleic acid were then precipitated from aqueous phase and washed thoroughly to remove
contaminating salts.
Material and methods
– CTAB buffer;
– Mortar and Pestle;
– Microfuge tubes;
http://en.wikipedia.org/wiki/Cetyl_trimethylammonium_bromide
http://en.wikipedia.org/wiki/Cetyl_trimethylammonium_bromide
Thi Lan Phuong Nguyen 42777982
18
– Microfuge;
– Liquid Nitrogen;
– 70 % Ethanol (ice cold);
– Absolute Ethanol (ice cold);
– 7.5 M Ammonium Acetate;
– 55
o
C water bath;
– Distilled water;
– Chloroform: Iso Amyl Alcohol (24:1);
– RNase (10mg/mL).
CTAB buffer 100ml
– 2.0 g CTAB (Hexadecyl trimethyl-ammonium bromide)
– 10.0 ml
1 M Tris pH 8.0
– 28.0 ml 5 M NaCl
– 4.0 ml 0.5 M EDTA pH 8.0 (EthylenediaminetetraAcetic acid Di-
sodium salt)
– 1 g PVP 40 (polyvinyl pyrrolidone (vinylpyrrolidine homopolymer)
Molecular weight 40,000)
– 40.0 ml H2O
Adjusted the solution to pH 5.0 with HCL and made up to 100 mL with H2O.
1 M Tris pH 8.0
Dissolved 121.1g of Tris base in 800 ml of H2O. pH was adjusted to 8.0 (by adding HCL). The
solution was allowed to cool down to room temperature before making the final
adjustments to the pH of 8.0. Added more distilled water to the final volume 1L then
sterilized by autoclaving.
Procedure
1. Ground 200 mg of tissue sample to a fine paste with approximately 500 μL CTAB
buffer; 1μL of GFP plasmid was also added at the same time to calculate the PCR efficiency
later.
2. Transfered all extract mixture to a microcentrifuge tube;
3. Incubated for about 15 min in a recirculating water bath at 55
o
C;
Thi Lan Phuong Nguyen 42777982
19
4. The CTAB/plant extract mixture was spin at 12000 g for 5 min to spin down cell
debris then the supernatant was transferred to fresh microfuge tubes;
5. To each tube 250 μL of Chloroform: Iso Amyl Alcohol (24:1) is added. The solution
was mixed by inversion then spun at 13000 rpm for 1 min. The upper aqueous phase was
transferred to a clean microfuge tube. This stage was repeated twice;
6. 50 μL of 7.5 M Ammonium Acetate was added to each tube before adding 500 μL of
ice cold absolute ethanol. These tubes were then incubated over night at -2
0
o
C;
7. After incubation, spined to form pellet at 13.2 x 1000g for 30 minutes. Discarded the
supernatant and the DNA pellet was washed by adding two changes of ice cold 70 %
ethanol;
8. The DNA pellet was then formed again by centrifugation at 12000 for 5 minutes;
9. The DNA was let to be dried at room temperature for 15 minutes and then
resuspended in 50 μL ultrapure water followed by adding 1 μL RNase (10 ng/mL) and
incubating at 37
o
C for 1 hour to remove RNA in the preparation;
10. The resuspended DNA was then incubated at 65
o
C for 20 minutes to destroy any
contaminated DNase and stored at 4
o
C until using.
4.2.1.2. Plant RNA extraction.
Total RNA from leaves were extracted by SV Total RNA isolation Kit (Promega). All the work
places and pipettes were decontaminated with the solution RNA AWAY (Invitrogen).
The RNA concentration was measured by spectrophotometer (NanoDrop® ND-1000). To
check the quality of the RNA, an agarose gel was run with ethidium bromide. The procedure
was conducted as follows:
1. Samples (leaves) harvesting was placed in centrifuge tube then put in liquid nitrogen
that employs in initial grinding stage. Abrasive sticks were used to break down cell wall and
cell membrane in about 30 seconds before the sample can be defrosted.
2. Added 175 μL SV RNA Lysis Buffer (already added BME) to tubes. Mix through by
inversion.
3. Added 350 μL SV RNA Dilution Buffer. Mix briefly by inverting 3 – 4 times.
4. Centrifuged for 10 minutes then transfered the clear lysate to a clear
microcentrifuge tube.
5. Applied 200 μL Ethanol 100% to clear lysate, mixed well by repeat pipetting.
Thi Lan Phuong Nguyen 42777982
20
6. Transfered the mixture to Spin Basket Assembly then centrifuged for 1 minute.
Eluate was discarded.
7. Added 600 μL SV RNA Wash Solution (already added ethanol) then centrifuged for 1
minute and discard eluate.
– Prepared DNase incubation mix as follows:
Solution Volume x Number of Preps = Total
Yellow Core
Buffer
MnCl2 0.09M
DNase I
40 μL
5 μL
5 μL
The solution was mixed well by pipet.
– Added 50 μL of DNase mix to membrane. Incubate for 15 minutes at room temperature.
– Added 200 μL SV DNase Stop Solution (+ethanol) then centrifuged for 1 minute.
– Added 600 μL SV RNA Wash solution (+ethanol), centrifuged for 1 minute
– Added 250 μL SV RNA Wash solution (+ethanol), centrifuged for 2 minute, then transferred
the Spin Basket to Elution Tube.
– Finally, 30 μL of nuclease–free water was added to membrane and centrifuged for 1
minute for eluting RNA and tried to keep immediately in ice or store at –
70
o
C until using.
4.2.2. Bacterial genomic DNA extraction.
1. Bacteria E.coli was incubated in 5mL of LB Broth overnight.
2. Divided 1.5 mL of culture into microfuge tube then centrifuged for 2 minutes to form
pellet. The supernatant was discarded.
3. The pellet was resuspended in 567 μL TE Buffer by repeat pipetting. 30 μL of 10%
SDS (Sodium dodecyl sulphate) was added to break cell membrane and then 3 μL of
20mg/mL proteinase K was applied to destroy proteins. Mixed well and incubation was at
37
o
C for 1 hour
4. Added 100 μL of 5M NaCl and mixed thoroughly.
5. 80 μL of CTAB/NaCl solution was added to dissolve DNA. The tube was mixed
thoroughly and incubated at 65
o
C for 10 minutes.
Thi Lan Phuong Nguyen 42777982
21
6. An equal volume (about 0.7 – 0.8 mL) of chloroform/isoamyl alcohol was added then
mixed thoroughly to denature protein. Such mixture was spun for 4 to 5 minutes in
microcentrifuge.
7. The aqueous, viscous supernatant was transferred to a fresh microcentrifuge tube by
pipetting while the interface behind was left. An equal volume of
phenol/chloroform/isoamyl alcohol was added and extracted thoroughly before spinning in
microcentrifuge for 5 minutes.
8. Transferred the supernatant to a new tube. 0.6 mL isopropanol was added to
precipitate nucleic acid. The tube was shaked back and forth until a stringy white DNA
precipitate was invisible clearly. The precipitate can be pelleted by spinning briefly while the
supernatant was removed.
9. Used pipet without touching to the pellet in order to wash DNA with 70% ethanol
which helped to remove remaining CTAB and NaCl then spined for 5 minutes at room
temperature to repellet.
10. Removed the supernatant carefully then redissolved the pellet in 100 μL distilled
water. DNA quality was confirmed by running electrophoresis gel. The DNA band appeared
at the top while many other smaller bands perform at the bottom.
TBE buffer recipe (1L)
54 g Tris base
20 ml of 0.5M EDTA (pH 8.0)
27.5 g boric acid
Added more distilled water until the final volume 1L
Prepared CTAB/NaCl solution
1. Dissolve 4.1 g NaCl in 80 ml of water
2. Add slowly 10 g CTAB while heating (65°C) and stirring. This step takes more than 3
hours to dissolve completely CTAB.
3. Adjust to the final volume of 100 mL
4. Sterilize by filter or autoclave.
A range of dilutions of the E.coli 16S amplicon were prepared as templates to produce a
calibration curve in the real time PCR. This curve is used to calculate for determining the
number of copies of a template per gram of soil.
Thi Lan Phuong Nguyen 42777982
22
4.2.3. DNA extraction from soil samples
In this study, PowerSoil
®
DNA Isolation Kit (MO BIO) was used to extract DNA from soil
samples. After the extraction, the DNA concentration was measured by spectrophotometer
NanoDrop and Qubit. To check the DNA quality, an agarose gel was run with ethidium
bromide. The protocol provided by the manufacturer was followed:
1. Placed 0.5 grams of soil sample to the PowerBead Tubes provided. 1µL of GFP plasmid
was added immediately after adding soil to quantify efficiency of PCR performance.
2. Mixed gently by vortex 2 to 3 seconds.
3. 60 µL of Solution C1 (without precipitation) was added then vortexed briefly or inverted
several times. If Solution C1 is precipitated, heat solution to
60
o
C until dissolved before use.
4. PowerBead Tubes were vortexed at maximum speed for 10 minutes then centrifuged at
10,000 x g for 30 seconds at room temperature.
5. Transferred supernatant to a fresh 2 ml Collection Tube (provided). At this time, the
supernatant may still contain some soil particles but the volume was expected around 400
µL to 500 µL.
6. 250 µL of Solution C2 was added and vortexed for 5 seconds. Incubated for 5 minutes at
4
o
C.
7. Centrifuged the tubes for 1 minute at 10,000 x g at room temperature.
8. Avoiding the pellet, transfer up to 600 µL of supernatant to a clean 2 ml Collection Tube
(provided).
9. 200 µL of Solution C3 was added and briefly vortexed before a short incubation at 4
o
C for
5
minutes.
10. The tubes were centrifuged at room temperature for 1 minute at 10,000 x g.
11. Avoiding the pellet, transferred up to 750 µL of supernatant to a clean 2 ml Collection
Tube (provided).
12. Shaked to mix Solution C4 then added 1200 µL of such solution to the supernatant and
briefly vortexed for 5 seconds.
13. Loaded approximately 675 µL onto a Spin Filter then centrifuged at room temperature
for 1 minute at 10,000 x g. Discarded the flow through then repeated adding 675 µL
supernatant and repeated centrifugation. The remaining supernatant then was applied onto
Thi Lan Phuong Nguyen 42777982
23
the Spin Filter and centrifuged in the same way. A total of three loads for each sample
processed were required.
14. Added 500 µL of Solution C5 and centrifuged at 10,000 x g for 30 seconds at room
temperature. Discarded the flow through.
15. Centrifuged at room temperature for 1 minute at 10,000 x g.
16. Carefully transferred the spin filter to a fresh 2 ml Collection Tube (provided).
17. 100 µL of Solution C6 was added to centre of the white filter membrane then
centrifuged at 10,000 x g for 30 seconds at room temperature.
18. Discarded the Spin Filter. The DNA collected in the tube was then ready for downstream
applications or stored at –
20
o
C until use.
4.2.4. Measure DNA concentration and checking the quality of DNA.
4.2.4.1. Quantification of DNA concentration
* Measure DNA, RNA concentration using NanoDrop® ND-1000 Spectrophotometer
The method that was based on UV absorbance measurements of nucleic acids at 260nm is
most commonly used and it can quantify a wide range of sample concentration from 2
ng/μL to 15 μg/μL. The ratio absorbance 260/280 performed the purity of DNA and RNA. A
ratio of at least 1.8 or 2.0 was generally accepted as pure for DNA and RNA, respectively.
Otherwise, lower ratios in either case indicated the presence of protein, phenol or any other
contaminants that can absorb at around 280nm wave length.
* Measure DNA concentration using Invitrogen Qubit® 2.0 Fluorometer
For DNA performing quantitative real-time PCR (qPCR), a precise measurement of
concentration was required.
The procedure was conducted as follows:
1. Prepared two Assay tubes (provided) for standards and one tube for each of sample
2. Prepared Working solution based on the volume of sample
Solution Volume x Number of Preps = Total
Qubit
TM
Buffer
Qubit
TM
Reagent
199 μL
1 μL
3. Prepared Assay tubes follows below table:
Thi Lan Phuong Nguyen 42777982
24
Solution Standard Assay tubes Sample Assay tubes
Working Solution 190 μL 180 – 199 μL
Standard (provided) 10 μL –
Sample – 1 – 20 μL
Total volume in each tube 200 μL 200 μL
4. Did vortex for 2 – 3 seconds
5. Incubated the tubes at room temperature for 2 minutes.
6. Inserted standard tubes in Qubit® 2.0 Fluorometer to set new standard followed by
inserting sample tubes to read results, refered to instruction on the screen [27].
Figure 2: The flow chart of measuring DNA concentration by Qubit
TM
assay
4.2.4.2. DNA quality confirmation
1. Prepared a 1 % solution of agarose by melting 0.5 gram of agarose in 50 mL of 0.5x
TBE buffer in a microwave for approximately 2 minutes.
2. Cooled down for a 2 minutes before adding 2.5 μL Ethidium Bromide, mixed briefly.
3. Applied a comp to a supplied tray then transferred all agar solution including
Ethidium Bromide into.
4. Allowed the gel casted for a minimum of 20 minutes at room temperature.
Thi Lan Phuong Nguyen 42777982
25
5. Carefully removed the comb.
6. Loaded the following into separate wells:
+ 5 μL 1kb ladder
+ 2 μL DNA sample + 1 μL Loading dye
6. Run the gel for 40 min at 100 V, 400 AMP
7. Exposed the gel under UV light. The presence of a highly resolved high molecular
weight band performs good quality DNA, meanwhile, the presence of a smeared band
indicates DNA degradation.
4.2.5. DNA amplification by PCR (Polymerase Chain Reaction).
In PCR tube (25 μL recipe)
PCR buffer with MgCl2 2.5 µL
dNTPs mix 0.5 µL
Forward primers 0.5 µL
Reverse primers 0.5 µL
Taq DNA Polymerase 0.5 µL
DNA sample 0.5 µL
Total 25 µL
Thermo-cycles
94
o
C 5 minutes
94
o
C 20 seconds
54
o
C 30 seconds
72
o
C 30 seconds
72
o
C 5 minutes
However, in the PCR with E.coli template, the annealing temperature increased to 61.5
o
C
instead of 54
o
C as above.
4.2.6. Clean up PCR products
Quick PCR clean up system was applied for special downstream application of quantitative
real time PCR. The Wizard® SV Gel and PCR Clean-Up System of Promega can eliminates
unincorporated primers and excessed dNTPs and got 95% recovery PCR product. The
protocol was conducted as follows:
Cycle repeated 40 times
Thi Lan Phuong Nguyen 42777982
26
* Prepare PCR product
An equal volume of Membrane Binding Solution was added to the PCR amplification.
* Binding of DNA
– Applied a SV Minicolumn into a Collection tube.
-Transfered the prepared PCR product to the Minicolumn assembly then incubated for 1
minute at room temperature.
– Centrifuged at 16000 x g for 1 minute and discarded flowthrough then reinserted the
Minicolumn into the Collection tube.
* Washing
– Added 700 µL Membrane Wash Solution (+ethanol) to the Minicolumn. Centrifuge for 1
minute at 16000 x g. Discard the flowthrough then reinserted Minicolumn into Collection
tube. This step was repeated with 500 µL Membrane Wash Solution (+ethanol). The
Minicolumn was centrifuged for 5 minutes at 16000 x g.
– Emptied the Collection tube then centrifuged column assembly with the opened
microcentrifuge lid for 3 minutes for evaporation of residual ethanol.
* Elution
– Transfered carefully the Minicolumn to a fresh microcentrifuge tube.
– Added 20 µL of Nuclease-free water to Minicolumn. Incubated for 1 minute at room
temperature then centrifuged for 3 minutes at 16000 x g.
– Finally, discarded Minicolumn and stored DNA at 4
o
C or -20
o
C [50].
4.2.7. cDNA synthesis
cDNA synthesis that was performed after RNA extraction was typically served for
downstream applications like RT-PCR. The quantification of RNA concentration was required
and then the RNA needs to be adjusted to 2.5 µg/µL
Prepare Master Mix
5X First – Strand buffer 4 µL
SupperScript
TM
III RT (20 u/ µL) 0.5 µL
0.1 M DTT 1 µL
Total 5.5 µL
In 0.2 mL PCR tube:
Thi Lan Phuong Nguyen 42777982
27
Up to 2.5 µg total RNA and MilliQ water 13.2 µL
Oligo dT (for eukaryote only) 0.2 µL
10mM dNTPs 1 µL
Total 14.5 µL
– The tube was mixed and incubated at 70
o
C for 5 minutes then quenched on ice for 2
minutes.
– Added Master mix to the tube.
– Kept at room temperature for 5 – 10 minutes before transferring to PCR machine.
Thermo-cycle
55
o
C 60 minutes
70
o
C 15 minutes
4
o
C hold forever
4.2.8. Quantitative RT – PCR (qRT-PCR)
The qRT-PCR was performed by Applied Biosystems 7900HT Fast Real-Time PCR System that
combined 384-well plate compatibility in the building 68, The University of Queensland,
Australia.
Recipe for each well
Cyber Green 5 µL
Primer mix (Forward and Reverse primers) 1 µL
DNA template 4 µL
Total 10 µL
The DNA used were PCR products amplified by the corresponding primers summarised as
bellow:
Table1: Primers were used for qRT-PCR
Name Common name Sequence
At1g49240 Beta-actin 8 GAGGATAGCATGTGGAACTGAGAA
At5g09810 Beta-actin 7 GAGGAAGAGCATTCCCCTCGTA
At3g15356 (R) Lec 1 GACCAAACTTTTCTTTTTCCGACTAA
At3g15356 (F) Lec 1 ATGGAAAGTCAGAAAACAACCTCATATT
Thi Lan Phuong Nguyen 42777982
28
rtSGFP_A GFP GGCATGGCGGACTTGAAG
rtSGFP_B GFP CAATGAGTATCTTATCCACAAGATGG
iASK_R (at5g26751) α-Shaggy kinase CTTATCGGATTTCTCTATGTTTGGC [51]
iASK_F (at5g26751) α-Shaggy kinase GAGCTCCTGTTAATTTAACTTGTACATACC [51]
ER-F2 E.coli 16S AGAAGCTTGCTCTTTGCTGA [52]
ER-R2 E.coli 16S CTTTGGTCTTGCGACGTTAT [52]
906F Universal E.coli 16S AGAAGCTTGCTCTTTGCTGA [50]
1062R Universal E.coli 16S CTTTGGTCTTGCGACGTTAT [50]
Firstly, the primers were diluted to the final concentration 0.3 µM, except the universal
primer pair of 906F+1062R that were diluted to 2.5 µM. Then, a mix containing the SYBR
Green and primers for each couple is prepared as mentioned on the recipe above. Three
technical replicates were included during the experiment to account for pipetting errors.
The program used for the thermocycler
94°C for 3 min
94°C for 1 min
60°C for 0.3 min
72°C for 1 min
72°C for 7 min
However, to qRT-PCR that was performed for universal primers, the annealing temperature
was reduced to 54°C as an optimal annealing temperature [50].
V. Results
In this project Lectin-1-overexpressing Arabidopsis plants were used to study plant-microbe
interactions. This is based on previous findings that the Lectin-1 protein binds to E. coli and
Pseudomonas syringae. Here we investigated whether rhizosphere bacteria are influenced
by the presence of lectin-1 that is transported and stored in root cell walls and exuded.
Previously, putative Lectin-1 transgenic T2 Arabidopsis plants were produced but plants did
not appear to be homozygous as spraying with Basta led seedlings to die.
Cycle repeated 25 times
Thi Lan Phuong Nguyen 42777982
29
5.1. Screening and selecting homozygous lectin-1-overexpressing
Arabidopsis plants
5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta
herbicide.
Lectin 1 Arabidopsis seeds were named as A1, A2, A3, A4, A5, A6, A7, A9, A10, A11 and were
germinated in separate wells in the same tray. One week later, some seeds begun sprouting
and after 13 days, seeds in all chambers sprouted. The table below shows germination rates
after 3 weeks.
Table2: The number of seed germinating
Overall, the seeds A2, A3, A5, A8, and A11 displayed the highest percentages of germination
with 59%, 26%, 70%, 55% and 70% respectively. However, seed A11 needed a longer time to
start germinating than other seeds.
Basta herbicide 1% was then used to select seeds that were homozygous (see methods).
Table 3 summarised plant survival rates after spraying.
Plant The number of germinated seeds
A1 20
A2 59
A3 26
A4 3
A5 70
A6 25
A7 13
A8 55
A9 13
A10 7
A11 70
Thi Lan Phuong Nguyen 42777982
30
Table 3: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after one week
Plant The percentage of surviving plants The percentage of become-yellow plants
A1 100% 35%
A2 100% 5%
A3 100% 3.8%
A4 100% 33.3%
A5 100% 2.8%
A6 100% 20%
A7 100% 7.6%
A8 100% 12.7%
A9 100% 7.6%
A10 100% 0
A11 100% 11.4%
Then Basta-spraying was repeated and the result observed after two weeks was showed in
table 4 and in figure 2:
Table 4: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after two weeks.
Plant The percentage of
surviving plants
The percentage of die
plants
The percentage of plants
with yellowing symptoms
A1 100% 0 35%
A2 100% 0 5%
A3 100% 0 3.8%
A4 66.67% 33.3% 0%
A5 98.6% 1.4% 2.8%
A6 100% 0 28%
A7 100% 0 15.38%
A8 100% 0 7.2%
A9 100% 0 7.6%
A10 100% 0 14.28
Thi Lan Phuong Nguyen 42777982
31
A11 100% 0 12.85%
Figure 3: Appearance of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after two weeks.
Table 4 shows that 33.3% of plants of A4 died and this percentage can be similar to
percentage of hybridization between heterozygous plants. The results suggest that A4 seeds
belong to a heterozygous plant while all other seeds are likely to be the progeny of
homozygous plants and hence these seeds are also homozygous. Half of Lectin-1 transgenic
T2 Arabidopsis plants were chosen for the next experiments to determine whether Lectin-1
was overexpressed. The seed genotypes that presented the healthiest seedlings after the
Basta sprayings were selected. Therefore, seeds A2, A3, A5, A8 showed the lowest
percentages of plants with yellowing symptoms, namely 5%; 3.8%; 2.8% and 7.2%,
respectively. Although one out of 70 plants of A5 presented 1.4% death rate, the seed A5
was considered homozygous and plants A5 looked overall greener than other ones after
spraying Basta, excepted the die plant that looked much smaller than others. The reason for
the death appeared to source from other factors, such as that those plants could not
compete to others to get enough nutrients and water.
5.1.2. Measurements of RNA concentrations from Arabidopsis plants
The selected genotypes of Lectin1-overproducing lines A2, A3, A5, A8 and wild type (WT)
were then germinated. After 2 to 3 weeks when plants reached 8-10-leaf stage, shoots were
harvested for RNA extraction.
Thi Lan Phuong Nguyen 42777982
32
The concentrations of RNA extracted from shoots were determined with both NanoDrop®
ND-1000 Spectrophotometer and Qubit(Invitrogen) (Table 3).
Table 5: Concentration of RNA extracting from plants
Samples RNA concentration
measuring by
NanoDrop
(ng/µL)
Ratio
260/280
RNA concentration
measuring by Qubit (ng/µL)
WT1 970.7 2.01 1220
WT2 560.6 2.1 1450
WT3 611.5 2.04 828
A2-1 1458.5 2.13 2060
A2-2 865 2.02 1160
A2-3 1206 2.1 1000
A3-1 596 2.08 460
A3-2 716.6 2.11 516
A3-3 1018.3 2.0 594
A5-1 1113.8 2.12 1550
A5-2 1441.2 2.06 1640
A5-3 1111.1 2.05 1360
A8-1 891.7 2.01 1110
A8-2 1156.6 2.09 1330
A8-3 1523.2 2.08 2180
Overall, the RNA concentrations were rather high. Besides, the ratios of 260/280 from
measuring by NanoDrop® ND-1000 Spectrophotometer were within the acceptable range
(1.8-2.2). Therefore, these RNA samples were utilized for performing cDNA synthesis for
further use in the qRT-PCR to quantify the Lectin 1 gene expression in wild type and Lectin-
1-overexpressing Arabidopsis plants.
5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR
To quantify expression levels of the Lectin 1 gene expressed in Arabidopsis plants, two sets
of primers were used: One for the amplification of the Lectin transcripts and one for Actin
transcripts that played the role as a house keeping gene in Arabidopsis thaliana. Based on
the Ct values and PCR efficiency values from qRT-PCR, relative expression of Lectin 1 gene to
Actin gene was determined (Table 4, Figure 1).
Thi Lan Phuong Nguyen 42777982
33
Table 6: Expression of Lectin 1 gene in Arabidopsis plants
Plant WT A2 A3 A5 A8
Average Biol. Rep. 0.366661 1.921221 1.263823 1.98152 1.808364
Standard Deviation 0.147542 0.08641 0.590564 0.150101 0.078753
Standard Error 0.085183 0.049889 0.340962 0.086661 0.045468
T-test 9.49956.
10
-5
0.063117 0.000185 0.000117
Figure 4: Relative expression of Lectin gene to Actin gene
Compared to the wild type, expressions values of Lectin 1 gene with 1.921221; 1.263823;
1.98152; 1.808364 in A2, A3, A5 and A8 plants, respectively were much higher than the
expression of 0.366661 in the wild type. Of them, plants of A5 showed the highest
expression level relative to actin (1.98152, P < 0,05). Hence A5 was chosen as the best
Lectin-1-overexpressing Arabidopsis genotype in this study, and was used in the subsequent
experiments
5.2. Evaluation of survival bacteria around Lectin-1–overexpressing
Arabidopsis thaliana.
To determine whether Lectin affect bacterial densities the rhizosphere or roots, , two
experiments using qRT-PCR to amplify E.coli 16S rRNA gene were conducted., One utilised
the primer pairs of ER-F2 and ER-R2 [52]. The other utilised universal bacterial primers 906F
Thi Lan Phuong Nguyen 42777982
34
and 1062R. Besides, a set of primers that amplify the GFP gene as well as the α-Shaggy
kinase gene (iASK) gene were used for rhizosphere soil and root samples, respectively..
Additionally, a range of dilutions of the E.coli 16S amplicon were prepared as templates to
produce a calibration curve in the real time PCR. This curve is used to calculate for
determining the number of copies of a template per gram of soil.
5.2.1. Quantify the concentration of DNA extracted from root and
rhizosphere
Initially, DNA extractions from root sample and soil samples were carried out and the DNA
concentration was measured as below:
Table 7: Concentration of DNA extracted from rhizosphere
Samples DNA concentration
measuring by
NanoDrop (ng/µL)
Ratio 260/280 DNA concentration
measuring by Qubit
(ng/µL)
WT1 18.2 1.77 8.78
WT2 12.1 1.67 6.6.2
WT3 11.8 1.70 5.60
A5-1 15.7 1.67 8.78
A5-2 17.0 1.90 10.6
A5-3 15.2 1.56 8.06
Table 8: Concentration of DNA extracting from roots
Samples DNA concentration measuring
by NanoDrop (ng/µL)
Ratio 260/280 DNA concentration
measuring by Qubit (ng/µL)
WT1 774.8 1.83 77
WT2 1344.7 1.91 123
WT3 904.8 1.86 100
A5-1 809.7 1.78 83
A5-2 686.9 1.70 108
A5-3 532.9 1.69 68.8
Thi Lan Phuong Nguyen 42777982
35
Overall, the DNA extracted from rhizosphere showed quite low concentrations while the
ones from root samples provided much higher yields.
5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers.
CT values of amplifications of DNA templates extracted from rhizosphere could not be
determined with the E. coli-specific 16S primers ER-F2 and ER-R2 that were revealed as the
most optimal ones for PCR of E.coli templates [52]. However, CT values obtained for root
samples were acceptable; hence all calculations were applied only to root DNA templates.
The α-Shaggy kinase plant gene (iASK) was used to measure relative bacterial abundance.
E.coli 16S abundance relative to the plant gene is shown in table 9.
Table 9: Expression of E.coli 16S copies relative to iASK gene
Plants Average Standard deviation Standard Error T-test
WT 68.24825349 15.33935 8.85617566 0.986599
A5 68.42902612 7.660091 4.422555381 0.245585
Figure 5: Relative expression of E.coli 16S sequence to iASK gene
Our results indicate that there was no significant difference in the abundance of E.coli in the
roots of wild type and transgenic plants (P > 0.05). To determine whether the primers could
amplify mitochondria DNA, a control sample of uninoculated axenically grown-root DNA
templates was included in the qRT-PCR. . A high Ct value for this sample (around 30), as
1.0095
11.0095
21.0095
31.0095
41.0095
51.0095
61.0095
71.0095
81.0095
WT LEC
E
.
co
li
1
6
S
r
e
la
ti
v
e
t
o
r
o
o
t
iA
S
K
Thi Lan Phuong Nguyen 42777982
36
opposed to 18 from E. coli-inoculated plants indicated that mitochondrial DNA amplification
was negligible.
5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers
(906F and 1062R)
Similarly to the other set of primers, for the primer pair 906F and 1062R, most of the CT
values for rhizosphere samples were undetermined. Relative abundances of E.coli 16S
copies to α-Shaggy kinase gene are shown in Table 10 and Figure 4.
Table 10: Expression of E.coli 16S sequence relative to iASK gene
Plants Average Standard deviation Standard Error T-test
WT 52.84153 36.05396 50.98801 0.730192
A5 36.56266 7.009206 12.1403 0.967496
Figure 6: Relative expression of E.coli 16S sequence to iASK gene
Similarly to the other set of primers tested, our results indicated that there was no
significant difference in E. coli abundance between the Lectin-1-overexpressing Arabidopsis
and the wild-type.
VI. Discussion
Quantification of Lectin-1 gene expression by qRT-PCR enabled the selection of A5 as the
genotype with the highest expression.
0
10
20
30
40
50
60
70
80
90
100
WT LEC
U
n
i
v
e
rs
a
l
1
6
S
r
e
la
ti
v
e
t
o
i
A
S
K
Thi Lan Phuong Nguyen 42777982
37
Such proteins have the ability to bind specifically and reversibly to carbohydrates with high
affinity [21]. Thus, lectins present on the root hair and secreted can specifically bind to
certain bacteria and initiate symbioses. Although lectins are found in various plant organs,
they seem to play the most important role in root tissues. The concentration is particularly
higher on the tips of developing root hairs, and they have also been localized in root
precursor cells [1]. Base on this background, the initial hypothesis assumed that the number
of bacteria E.coli in Lectin-1-overexpressing plant might decrease compared to that one
around wild type plants. Additionally, the previous study of Xavier (2012) indicates that
lectins decreases the number of E.coli in the rhizosphere soil [53].
However, comparisons of E.coli abundance in roots of Lectin-1-overexpressing line and the
wild type revealed no difference, although using two independent primer sets, one specific
for 16S from E. coli and another universal for 16S from bacteria in general.
With regard to qRT-PCR with DNA template extracted from rhizosphere, most Ct values
were undetermined even when universal primers were used (906F, 1062R). Thus, results
from previous research which reported that lectins affect the number of rhizosphere
bacteria could not be confirmed. The possible reason for undetermined Ct values can be the
very low DNA template concentration (5.6 ng/µL). Since this amount was not enough to
amplify the DNA template, Ct values were most undetermined or very high (over 40). This
study used DNA extraction Kits with 0.5 gram of soil, instead of RNA extraction method that
used 4 gram of sample as in the previous research of Xavier [53], so the quality of DNA
extracted could be different. Besides, the transgenic line in that study was also different as it
was heterozygous.
Hence, although there is evidence indicating that the significant presence of protein lectin
into the root cell wall can support the defence barrier of plant [20], the interaction between
lectins and bacteria has been a question. The E.coli that were utilized in this study is not an
environmental bacterium and does not naturally interact with Arabidopsis thaliana [54].
Thus, in the next study, other bacteria should be used for the inoculation such as
Pseudomonas aeruginosa that present commonly in variety of environments, especially in
water and soil. In a study, Walker et al. (2004) reported that pathogenic P. aeruginosa
strains PAO1 and PA14 are capable to infect the roots of Arabidopsis thaliana in vitro and in
the soil, and are capable of causing plant mortality of 7 day-postinoculation [55]. So, further
Thi Lan Phuong Nguyen 42777982
38
study with these bacteria can generate clues to answer the question of whether the lectin
protein can be actually plays the role in plant pathogen defence.
In addition, other methods of DNA extraction should also be applied to get higher yields of
DNA from rhizosphere soil. However, it is highly recommend the use of homozygous lectin-
1-overexpressing Arabidopsis thaliana for such study and the longer time of bacteria
inoculation in rhizophore also can be also considered.
VII. Conclusion
This study has identified a homozygous line of lectin-1-overexpressing Arabidopsis thaliana.
Moreover, the best lectin-expression line was selected and can be used in downstream
studies.
This study indicated that after two weeks after E. coli inoculation of lectin-1-overexpressing
Arabidopsis thaliana, the number of bacteria E.coli in roots did not decrease compared to
the wild type. Hence, lectins from protein in Arabidopsis thaliana did not appear to
influence E.coli abundance in roots. Thus, further studies should be conducted with others,
particularly pathogen to confirm the role of lectin protein in pathogen resistance in plants.
Thi Lan Phuong Nguyen 42777982
39
References
1. Hirsch, A.M., Role of lectins (and rhizobial exopolysaccharides) in legume nodulation.
Current Opinion in Plant Biology 1999. 2: p. 320–326.
2. Konopka, A., What is microbial community ecology[quest]. ISME J, 2009. 3(11): p.
1223-1230.
3. Carvalhais, L.C., et al., Rhizosphere Metatranscriptomics: Challenges and
Opportunities, in Molecular Microbial Ecology of the Rhizosphere. 2013, John Wiley &
Sons, Inc. p. 1137-1144.
4. Carvalhais, L.C., et al., Application of metatranscriptomics to soil environments.
Journal of Microbiological Methods, 2012. 91(2): p. 246-251.
5. Andrews, M., S. Hodge, and J.A. Raven, Positive plant microbial interactions. Annals
of Applied Biology, 2010. 157(3): p. 317-320.
6. Schenk, P.M., L.C. Carvalhais, and K. Kazan, Unraveling plant–microbe interactions:
can multi-species transcriptomics help? Trends in Biotechnology, 2012. 30(3): p. 177-
184.
7. Doornbos, R.F., et al., Effects of Jasmonic Acid, Ethylene, and Salicylic Acid Signaling
on the Rhizosphere Bacterial Community of Arabidopsis thaliana. Molecular Plant-
Microbe Interactions, 2010. 24(4): p. 395-407.
8. Pieterse, C.M.J., et al., Signalling in Rhizobacteria-Induced Systemic Resistance in
Arabidopsis thaliana. Plant Biology, 2002. 4(5): p. 535-544.
9. Funnell, D.L., C.L. Schardl, and P. Bednarek, Plant Defence against Fungal Attack:
Biochemistry, in eLS. 2001, John Wiley & Sons, Ltd.
10. Armah, C.N., et al., The Membrane-Permeabilizing Effect of Avenacin A-1 Involves the
Reorganization of Bilayer Cholesterol. Biophysical Journal, 1999. 76(1): p. 281-290.
Thi Lan Phuong Nguyen 42777982
40
11. Cruz-Cruz, C., et al., Phytoanticipins from banana (Musa acuminata cv. Grande
Naine) plants, with antifungal activity against Mycosphaerella fijiensis, the causal
agent of black Sigatoka. European Journal of Plant Pathology, 2010. 126(4): p. 459-
463.
12. Carvalhais, L.C., et al., Activation of the Jasmonic Acid Plant Defence Pathway Alters
the Composition of Rhizosphere Bacterial Communities. PLoS ONE, 2013. 8(2): p.
e56457.
13. Rasmann, S. and A.A. Agrawal, In Defence of Roots: A Research Agenda for Studying
Plant Resistance to Belowground Herbivory. Plant Physiology, 2008. 146(3): p. 875-
880.
14. Jonathan P. Anderson, E.B., Peer M. Schenk, John M. Manners, Olivia J. Desmond,
Christina Ehlert, Donald J. Maclean, Paul R. Ebert, and Kemal Kazana., Antagonistic
Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways
Modulates Defence Gene Expression and Disease Resistance in Arabidopsis. The Plant
Cell, 2004. 16(12): p. 3460-3479.
15. Kachroo, A. and P. Kachroo, Salicylic Acid-, Jasmonic Acid- and Ethylenemediated
Regulation of Plant Defence Signaling, in Genetic Engineering, J. Setlow, Editor. 2007,
Springer US. p. 55-83.
16. McConn, M., et al., Jasmonate is essential for insect defence in Arabidopsis.
Proceedings of the National Academy of Sciences, 1997. 94(10): p. 5473-5477.
17. Vijayan, P., et al., A role for jasmonate in pathogen defence of Arabidopsis.
Proceedings of the National Academy of Sciences, 1998. 95(12): p. 7209-7214.
18. Li, C., et al., Resistance of Cultivated Tomato to Cell Content-Feeding Herbivores Is
Regulated by the Octadecanoid-Signaling Pathway. Plant Physiology, 2002. 130(1): p.
494-503.
19. Bouizgarne, B., Bacteria for Plant Growth Promotion and Disease Management, in
Bacteria in Agrobiology: Disease Management, D.K. Maheshwari, Editor. 2013,
Springer Berlin Heidelberg. p. 15-47.
20. Schenk, P., A lectin family in Arabidopsis is activated by multiple defence pathways
and confers resistance against nematodes and pathogenic bacteria, 2010, The
University of Queensland.
21. Damme, W.J.P.a.E.J.M.V., Lectins as PIant Defence Proteins. Plant Physiol., 1995. 109:
p. 347-352.
22. Parijs, J., et al., Hevein: an antifungal protein from rubber-tree (Hevea brasiliensis)
latex. Planta, 1991. 183(2): p. 258-264.
Thi Lan Phuong Nguyen 42777982
41
23. Czapla, T.H. and B.A. Lang, Effect of Plant Lectins on the Larval Development of
European Corn Borer (Lepidoptera: Pyralidae) and Southern Corn Rootworm
(Coleoptera: Chrysomelidae). Journal of Economic Entomology, 1990. 83(6): p. 2480-
2485.
24. Kumar MA, T.D., Neet KE, Owen WG, Peumans WJ, Rao AG., Characterization of the
lectin from the bulbs of Eranthis hyemalis (winter aconite) as an inhibitor of protein
synthesis. THE JOURNAL OF BIOLOGICAL CHEMISTRY, 1993. 268(33)(November 25):
p. 25176-2518.
25. L. Sequeira, T.L.G., Agglutination of avirulent strains of Pseudomonus solanacearum
by potato lectin. Physiol Plant Pathology 1977. 11(1) p. 43-54.
26. Maria Prihtamala Omega, S.T.-H., Peer Schenk and Bostjan Kobe, A highly abundant
lectin protein Arabidopsis thaliana confers resistance against pathogens. ANNALES
BOGORIENSES, 2008. 12(01).
27. Wahl, V., et al., Regulation of Flowering by Trehalose-6-Phosphate Signaling in
Arabidopsis thaliana. Science, 2013. 339(6120): p. 704-707.
28. Hancock, A.M., et al., Adaptation to Climate Across the Arabidopsis thaliana
Genome. Science, 2011. 334(6052): p. 83-86.
29. Lugtenberg, B. and F. Kamilova, Plant-Growth-Promoting Rhizobacteria. Annual
Review of Microbiology, 2009. 63(1): p. 541-556.
30. Dennis, P.G., A.J. Miller, and P.R. Hirsch, Are root exudates more important than
other sources of rhizodeposits in structuring rhizosphere bacterial communities?
FEMS Microbiology Ecology, 2010. 72(3): p. 313-327.
31. Hein, J., G. Wolfe, and K. Blee, Comparison of Rhizosphere Bacterial Communities in
Arabidopsis thaliana Mutants for Systemic Acquired Resistance. Microbial Ecology,
2008. 55(2): p. 333-343.
32. Harrison, S., et al., A rapid and robust method of identifying transformed Arabidopsis
thaliana seedlings following floral dip transformation. Plant Methods, 2006. 2(1): p.
19.
33. Ghazanfar, S., et al., Metagenomics and its application in soil microbial community
studies: biotechnological prospects. Journal of Animal & Plant Sciences, 2010. 6(2): p.
611-622.
34. Rondon, M.R., et al., Cloning the Soil Metagenome: a Strategy for Accessing the
Genetic and Functional Diversity of Uncultured Microorganisms. Applied and
Environmental Microbiology, 2000. 66(6): p. 2541-2547.
Thi Lan Phuong Nguyen 42777982
42
35. Delmont, T.O., et al., Accessing the Soil Metagenome for Studies of Microbial
Diversity. Applied and Environmental Microbiology, 2011. 77(4): p. 1315-1324.
36. Roesch, L., et al., Pyrosequencing enumerates and contrasts soil microbial diversity.
The ISME Journal, 2007. 1(4): p. 283-90.
37. van Elsas, J.D., et al., The metagenomics of disease-suppressive soils – experiences
from the METACONTROL project. Trends in Biotechnology, 2008. 26(11): p. 591-601.
38. Boubakri, H., et al., Development of metagenomic DNA shuffling for the construction
of a xenobiotic gene. Gene, 2006. 375(0): p. 87-94.
39. Schloss, P.D. and J. Handelsman, Biotechnological prospects from metagenomics.
Current Opinion in Biotechnology, 2003. 14(3): p. 303-310.
40. Demanèche, S., et al., Antibiotic-resistant soil bacteria in transgenic plant fields.
Proceedings of the National Academy of Sciences, 2008. 105(10): p. 3957-3962.
41. Courtois, S., et al., Recombinant environmental libraries provide access to microbial
diversity for drug discovery from natural products. Applied and Environmental
Microbiology, 2003. 69(1): p. 49-55.
42. Jordan, J.A., A.R. Butchko, and M. Beth Durso, Use of Pyrosequencing of 16S rRNA
Fragments to Differentiate between Bacteria Responsible for Neonatal Sepsis. The
Journal of Molecular Diagnostics, 2005. 7(1): p. 105-110.
43. Dethlefsen, L., et al., The Pervasive Effects of an Antibiotic on the Human Gut
Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biol, 2008. 6(11): p.
e280.
44. Huse, S.M., et al., Exploring Microbial Diversity and Taxonomy Using SSU rRNA
Hypervariable Tag Sequencing. PLoS Genet, 2008. 4(11): p. e1000255.
45. Gary D Wu, J.D.L., Christian Hoffmann, Ying-Yu Chen, Rob Knight, Kyle Bittinger,
Jennifer Hwang, Jun Chen, Ronald Berkowsky, Lisa Nessel, Hongzhe Li and Frederic D
Bushman, Sampling and pyrosequencing methods for characterizing bacterial
communities in the human gut using 16S sequence tags. BMC Microbiology, 2010. 10
(206).
46. Wang, Q., et al., Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences
into the New Bacterial Taxonomy. Applied and Environmental Microbiology, 2007.
73(16): p. 5261-5267.
47. Ludwig, W., et al., ARB: a software environment for sequence data. Nucleic acids
research, 2004. 32(4): p. 1363-1371.
Thi Lan Phuong Nguyen 42777982
43
48. Shani, E., et al., Gibberellins accumulate in the elongating endodermal cells of
Arabidopsis root. Proceedings of the National Academy of Sciences, 2013. 110(12): p.
4834-4839.
49. Center, A.B.R. Handling Arabidopsis plants and seeds 2009 [cited 2013 May 3th];
Available from: http://www.biosci.ohio-
state.edu/~plantbio/Facilities/abrc/handling.htm.
50. Bacchetti De Gregoris, T., et al., Improvement of phylum- and class-specific primers
for real-time PCR quantification of bacterial taxa. Journal of Microbiological
Methods, 2011. 86(3): p. 351-356.
51. Gachon, C. and P. Saindrenan, Real-time PCR monitoring of fungal development in
Arabidopsis thaliana infected by Alternaria brassicicola and Botrytis cinerea. Plant
Physiology and Biochemistry, 2004. 42(5): p. 367-371.
52. Dong Hyuck Lee, J.E.B., Jung Hee Lee, Jeong Sup Shin, In Seop Kim, Quantitative
Detection of Residual E. coli Host Cell DNA by Real-Time PCR. Journal of Microbiology
and Biotechnology, 2010 20(10): p. 1463-1470.
53. Xavier, D., The role of lectins in plant-microbe interactions 2011, The University of
Queensland.
54. Paungfoo-Lonhienne, C., et al., Turning the Table: Plants Consume Microbes as a
Source of Nutrients. PLoS ONE, 2010. 5(7): p. e11915.
55. Walker, T.S., et al., Pseudomonas aeruginosa-Plant Root Interactions. Pathogenicity,
Biofilm Formation, and Root Exudation. Plant Physiology, 2004. 134(1): p. 320-331.
http://www.biosci.ohio-state.edu/~plantbio/Facilities/abrc/handling.htm
http://www.biosci.ohio-state.edu/~plantbio/Facilities/abrc/handling.htm
- 2
The Arabidopsis Book ©2002 American Society of Plant Biologists
Pseudomonas syringae is a Gram-negative, rod-shaped
bacterium with polar flagella (Figure 1; Agrios, 1997).
Strains of P. syringae collectively infect a wide variety of
plants. Different strains of P. syringae, however, are
known for their diverse and host-specific
interactions
with plants (Hirano and Upper, 2000). A specific strain
may be assigned to one of at least 40 pathovars based
on its host range among different plant species (Gardan
et al., 1999) and then further assigned to a race based on
differential interactions among cultivars of the host plant.
Understanding the molecular basis of this high level of
host specificity has been a driving force in using P.
syringae as a model for the study of host-pathogen
interactions. In crop fields, infected seeds are often an
important source of primary inoculum in P. syringae
diseases, and epiphytic bacterial growth on leaf surfaces
often precedes disease development (Hirano and Upper,
2000). P. syringae enters the host tissues (usually leaves)
through wounds or natural openings such as stomata,
and in a susceptible plant it multiplies to high population
levels in intercellular spaces. Infected leaves show
water-soaked patches, which eventually become
necrotic. Depending on P. syringae strains, necrotic
lesions may be surrounded by diffuse chlorosis. Some
strains of P. syringae also cause cankers and galls
(Agrios, 1997). In resistant plants, on the other hand, P.
syringae triggers the hypersensitive response (HR), a
rapid, defense-associated death of plant cells in contact
with the pathogen (Klement, 1963; Klement et al., 1964;
Bent, 1996; Greenberg, 1996; Dangl et al., 1996;
Hammond-Kosack and Jones, 1997). In this situation, P.
syringae fails to multiply to high population levels and
causes no disease symptoms.
In the late 1980s, several strains belonging to pathovars
tomato, maculicola, pisi, and atropurpurea of
Pseudomonas syringae were discovered to infect the
model plant Arabidopsis thaliana (reviewed by Crute et al.,
1994). The establishment of the Arabidopsis-P. syringae
pathosystem triggered a period of highly productive
research that has contributed to the elucidation of the
fascinating mechanisms underlying plant recognition of
pathogens, signal transduction pathways controlling plant
defense responses, host susceptibility, and pathogen
virulence and avirulence determinants. In this chapter we
trace the discovery of this pathosystem, overview the most
salient aspects of this interaction, and point out the gaps
in our knowledge. At the end of this chapter we will also
provide a glossary of relevant pathology-related technical
terms (Appendix I), a list of people who are studying this
interaction so readers can seek help if they have further
The Arabidopsis Thaliana-Pseudomonas Syringae
Interaction
Fumiaki Katagiria, Roger Thilmonyb, and Sheng Yang Heb
aPlant Health Department, Torrey Mesa Research Institute, 3115 Merryfield Row, San Diego, CA 92121, USA
bDepartment of Energy Plant Research Laboratory, Michigan State University, East Lansing, MI 48824, USA.
Corresponding Author:
Sheng Yang He
206 Plant Biology Bldg.
Plant Research Laboratory
Michigan State University
East Lansing, MI 48824, USA
Tel: (517) 353-9181
Fax: (517) 353 –9168
E-mail: hes@msu.edu
Introduction
The Arabidopsis Book ©2002 American Society of Plant Biologists
First published on March 27, 2002; doi: 10.1199/tab.0039
The Arabidopsis Book 2 of 35
questions about the Arabidopsis-P. syringae interaction
(Appendix II), and several experimental procedures
commonly used in the study of the Arabidopsis-P. syringae
interaction (Appendix III).
1. EARLY DEVELOPMENT OF THE ARABIDOPSIS-
PSEUDOMONAS SYRINGAE SYSTEM
1.1. Beginning: Are there any Arabidopsis pathogens?
In the 1980s, P. syringae was the first pathogen to be
demonstrated to infect Arabidopsis and to cause disease
symptoms in the laboratory setting. This was achieved by
screening many P. syringae strains on various Arabidopsis
accessions (Dong et al., 1991; Whalen et al., 1991; Dangl
et al., 1992). The two virulent strains most widely used
today, P. syringae pv. tomato DC3000 and P. syringae pv.
maculicola ES4326, originated from these early studies.
When a suspension of 108 bacteria/ml (a high dose of
bacteria) is sprayed with a surfactant onto susceptible
Arabidopsis plants (e.g., ecotype Columbia), the first sign
of disease is the appearance of “water-soaked” patches
on leaves on day 2. The water-soaked symptom results
from massive release of water and, presumably, nutrients
from infected Arabidopsis cells. The water-soaked
patches become necrotic and dark-colored on day 3, and
the surrounding leaf tissue shows extensive chlorosis,
giving the characteristic appearance of a ‘speck’ disease
(Figure 2, Figure 3E and 3F). In addition, closely related,
but avirulent strains (such as P. syringae pv. tomato
JL1965 and P. syringae pv. maculicola M2) that became
sources of some avirulence (avr) genes were also identified
(Dong et al., 1991; Whalen et al., 1991; Dangl et al., 1992).
The main reason for examining P. syringae strains as
potential pathogens of Arabidopsis was because P.
syringae had already been proven to be an excellent
genetically tractable pathogen of soybean, tomato, and
bean in the mid-1980s (Keen, 1990). Development of the
Arabidopsis-P. syringae pathosystem would provide a
system in which both the plant and the pathogen are
amenable to rigorous genetic analysis. However, it is
interesting to note that even after the demonstration of
disease symptoms caused by P. syringae on Arabidopsis,
not many people were convinced that this was a good
model system for two reasons: there was no report of
naturally occurring P. syringae disease in Arabidopsis in
the wild, and in the laboratory inoculation required artificial
methods (infiltration or use of surfactant).
1.2. Establishing the system: gene-for-gene
Figure 1. A transmission electron microscope image of
Pseudomonas syringae pv. tomato DC3000. Note that
DC3000 produces polar flagella (15 nm in diameter) and a
few Hrp pili (8 nm in diameter). The flagella and Hrp pili are
indicated with arrows. Flagella enable bacteria to swim
toward or away from specific chemical stimuli. Hrp pili are
involved in type III secretion of avirulence and virulence pro-
teins.
Figure 2. Disease symptoms in Arabidopsis leaves caused
by DC3000 infection. Leaves (indicated with arrows) were
syringe-infiltrated with 5 x 105 cfu/mL of Pst DC3000 and
pictures were taken four days after inoculation. The whole
plant is shown in (A). A close-up of a diseased leaf is shown
in (B).
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 3 of 35
interactions
A significant milestone in the development of the
Arabidopsis-P. syringae system was the demonstration
that this pathosystem conforms to the gene-for-gene
relationship that underlies many well-known plant-
pathogen interactions in nature (such as the flax-rust
fungus interaction or the soybean-P. syringae interaction)
(Keen, 1990). The gene-for-gene hypothesis was
advanced by H.H. Flor, based on his work on the flax-rust
fungus interaction in the 1940s and 1950s (Flor, 1971).
This hypothesis states that when a pathogen (in this case
a P. syringae strain) has an avirulence (avr) gene, and a
plant host (in this case the Arabidopsis plant) has the
corresponding disease resistance (R) gene, the plant is
resistant to the pathogen (Table 1). It is defined by a single
plant R gene for a single pathogen avr gene, hence the
name gene-for-gene resistance. Table 2 defines the
terminology involved in gene-for-gene resistance. When
the plant is resistant, the pathogen is said to be avirulent
and the interaction is said to be incompatible. When the
plant is susceptible, the pathogen is said to be virulent and
the interaction is said to be compatible. The laboratories
of Fred Ausubel and Brian Staskawicz showed that an avr
gene, avrRpt2, from an avirulent P. syringae pv. tomato
strain, JL1065, converted DC3000 and ES4326 into
avirulent strains in the Arabidopsis ecotype Columbia
(Dong et al., 1991; Whalen et al., 1991). Subsequent
Arabidopsis mutagenesis and screening efforts led to the
identification of mutations in the Arabidopsis RPS2
disease resistance gene (Kunkel et al., 1993; Yu et al.,
1993). Thus, a demonstration of the avrRpt2-RPS2 gene-
for-gene interaction was completed. Similar efforts in the
laboratory of Jeff Dangl led to the identification of the
avrRpm1 gene in P. syringae pv. maculicola strain M2 and
the RPM1 resistance gene in Arabidopsis ecotype
Columbia (Dangl et al., 1992). Interestingly, the RPM1
resistance gene also recognizes avrB, which was isolated
initially from P. syringae pv. glycinea in the soybean-P.
syringae interaction (Bisgrove et al., 1994). These
pioneering efforts spurred subsequent research to identify
additional P. syringae avr genes and the corresponding
Arabidopsis resistance gene loci, the eventual cloning of
the first Arabidopsis resistance gene, RPS2 (Bent et al.,
1994; Mindrinos et al., 1994), and identification of non-R
gene plant components involved in gene-for-gene
resistance (see section 3.1.5).
Early concerns about the lack of natural infection and
artificial inoculation methods have still not been
addressed, but the Arabidopsis-P. syringae system has
flourished as a widely recognized model plant-pathogen
system. This fact presents us a lesson on what is
important in developing a new model system. A model
system cannot address every single aspect of a natural
system. For example, the Arabidopsis-P. syringae system
is probably not an appropriate system to model a bacterial
invasion process seen in P. syringae infection of beans in
the field because P. syringae infection of Arabidopsis
requires an artificial infection method. However, it has
been a great system in which to study broadly observed
phenomena, such as gene-for-gene interactions. Thus, we
have to define appropriate questions to ask in a model
system; it is not reasonable to dismiss a model system
simply because it cannot address every single aspect of
natural systems.
Success in the Arabidopsis-P. syringae system
encouraged development of other Arabidopsis pathogen
systems (see chapters by Dangl, Somerville, Innes,
Buell, and Crute). At the same time, comparisons with
other plant-pathogen systems, especially the
Arabidopsis-Peronospora parasitica system, have helped
advancement of the Arabidopsis-P. syringae system.
2. EARLY INTERACTIONS IN THE ARABIDOPSIS
INTERCELLULAR SPACE (APOPLAST)
The Arabidopsis Book 4 of 35
Figure 3. Disease symptom development in a susceptible Arabidopsis plant 1, 2, 3 and 4 days after inoculation. Leaves were
vacuum infiltrated with 1 x 106 bacteria/ml of DC3000. A picture was taken before inoculation (A) immediately after vacuum infil-
tration (B) and every day for 4 days (C to F). To the right of each picture is a plot of the level of bacteria present within the leaves
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 5 of 35
at that particular time. Note, water-soaking symptoms, appeared at 48 to 60 hours. Significant chlorosis and necrosis occurred
at 72 to 96 hours after inoculation. Note that bacteria multiplied to a near maximum level before chlorosis or massive cell death
appeared.
The Arabidopsis Book 6 of 35
As mentioned above, P. syringae often first flourishes on
the surface of plants as an epiphyte in the wild before it
enters the intercellular space to initiate pathogenesis
(Hirano and Upper, 2000). The ability of P. syringae to grow
epiphytically is ecologically important for pathogen
survival and spread in the field and is a topic of intensive
study. In the laboratory, however, where the Arabidopsis-
P. syringae system is studied, we often bypass the
epiphytic growth phase and place P. syringae directly in
the intercellular space by syringe injection, or we artificially
facilitate the entry of P. syringae into the intercellular space
by spraying leaves with high doses of bacterial suspension
in the presence of a surfactant (e.g., Silwet L-77). In
addition, the commonly used strain DC3000 is a very poor
epiphyte in the field (Kyle Willis, University of Wisconsin,
Madison, personal communication) and therefore, the
Arabidopsis-P. syringae interaction is not a good model for
the study of epiphytic interaction. In this chapter, which is
focused on the Arabidopsis-P. syringae pathogenic
interaction, we therefore begin our discussion with the
events occurring immediately after P. syringae arrives in
the intercellular space, where bacteria are in direct contact
with Arabidopsis cells that are about 10,000 times larger,
are enveloped with a >100 nm thick cell wall, and are full
of exploitable photosynthates behind the wall (Figure 4).
The mesh size of the cell wall is in the order of 20 to 30 nm,
and this is too small for a bacterium of a few µm to simply
penetrate. Both P. syringae and Arabidopsis must react to
this situation quickly, obviously for different reasons.
Whatever happens in the first few hours of the encounter
will determine whether P. syringae will be successful in
becoming a virulent pathogen of Arabidopsis or the
Arabidopsis plant will effectively stop further infection of P.
syringae.
The precise details of the early events after P. syringae
enters the leaf apoplast are still not clear, but a few key
steps have been revealed or can be speculated about.
From the plant side, it is believed that Arabidopsis (and
presumably all other plants) have developed mechanisms
to detect the invasion of any microbe and respond with the
first line (a basal level) of general defense and that this
defense is effective enough to stop some microbes (e.g.,
saprophytes, which lack the ability to flourish in the living
tissues). The first line of defense is not well characterized
but presumably involves expression of some defense
genes (Jakobek et al., 1993). It is relatively benign – it does
not sacrifice the plant cell under attack. However, it is still
costly to the cell, and that is why it is regulated. How
Arabidopsis cells detect the presence of a microbe at this
stage is not clear, but it likely involves sensing of
constitutively expressed extracellular molecules or
structures of the microbe. One example may be the
bacterial flagellin protein, the structural protein of the
bacterial flagellum. Felix et al. (1999) showed that a
peptide whose sequence is well conserved among
flagellins of eubacteria, including Pseudomonas, can elicit
general defense responses in plants (Felix et al., 1999). An
Arabidopsis gene involved in the perception of this
peptide, FLS2, has been cloned and it encodes a leucine-
rich-repeat (LRR) receptor-like protein kinase (Gomez-
Gomez and Boller, 2000). Thus, the putative FLS2
receptor can potentially respond to a wide variety of
bacterial pathogens, including P. syringae, and activate a
general defense response. It is interesting that flagellins of
Agrobacterium and Rhizobium, which do not elicit strong
defense in plants, do not have this peptide sequence
conserved (Felix et al., 1999).
For P. syringae, the plant intercellular space is a potential
niche from which to exploit the bulk of photosynthates and
other nutrients hidden behind the host cell wall. The
normal apoplast is believed to be limited in water and
possibly nutrients (although theoretical considerations
argue for sufficient nutrients in the apoplast, see Hancock
and Huisman, 1981) and is a depository for some plant
defense compounds. In order to flourish and attain an
extremely high population density (typically 5×107
bacteria/cm2) in the apoplast, P. syringae must produce
appropriate virulence factors to cause Arabidopsis cells to
‘leak’ nutrients and water into the intercellular space and at
the same time to suppress or evade Arabidopsis defense
aimed at inhibiting bacterial proliferation. Because no
massive host cell death occurs before P. syringae has
achieved a near maximum population in infected leaves
Figure 4. A scanning electron microscopic image of a cross
section of an Arabidopsis (ecotype Columbia; susceptible)
leaf infected with DC3000. HC: host cells. Ba: Bacteria.
Arrows indicate the direction of type III secretion from bacte-
ria in the apoplast into the host cell interior. Note that the
host cell wall remains intact, physically separating bacteria
and host cells until the very late stages of the interaction,
when host cells collapse.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 7 of 35
(Figure 3), it is believed that nutrient and water release from
host cells during the early to mid (probably most critical)
stages of P. syringae infection is not caused by nonspecific
host cell rupture. The exact arsenal of P. syringae virulence
factors has not been determined, but two virulence
systems have been shown to play a key role: the type III
protein secretion system that delivers a battery of bacterial
avirulence and virulence proteins (type III effectors,
hereinafter) to the apoplast and also into the Arabidopsis
cells (Alfano and Collmer, 1997; Lindgren, 1997; He, 1998;
Preston, 2000) and a diffusible toxin coronatine that
partially mimics plant hormone methyl jasmonate (MeJA)
(Bender et al., 1999; Preston, 2000). Both of these
virulence systems are induced in plant tissues, presumably
because they are not needed before bacteria encounter
plant cells. A detailed description of these two virulence
systems will be presented in section 4, but it is important
to mention here that direct injection of bacterial virulence
proteins into host cells via the type III secretion system is
a widespread phenomenon in bacterial pathogens of
plants and animals, and is considered to be an
evolutionarily critical invention of bacterial pathogens (He,
1998; Hueck, 1998; Galan and Collmer, 1999).
Once P. syringae has injected type III effector proteins,
which include Avr proteins (see below for more discussion
of the relationship between Avr proteins and type III
effector proteins), into Arabidopsis cells via the type III
protein secretion system, there are two outcomes,
depending on the genotypes of the infecting P. syringae
and Arabidopsis plants. These two outcomes are most
elegantly (albeit in an oversimplified manner) explained by
the gene-for-gene hypothesis, i.e., if an infected
Arabidopsis plant has an R gene that recognizes a P.
syringae type III effector (i.e., an Avr protein in this
situation), a rapid defense mechanism of the plant will be
triggered. Alternatively, if the infected Arabidopsis plant
has no corresponding R gene and/or the P. syringae strain
has no avr gene, defense responses will be activated
slowly, the infection will continue, and the plant will
succumb to P. syringae and become diseased. In a given
Arabidopsis-P. syringae system, it is possible that more
than one specific combination of avr and R genes are
operating at the same time, and such different
combinations are often co-dominant (Table 3). For
example, it is possible to have a strain of P. syringae
carrying avr genes interacts with an Arabidopsis plant
carrying two corresponding R genes. The two
combinations, avr1/R1 and avr2/R2, may be co-dominant
in the system.
All known P. syringae avr genes (with the exception of
avrD; Keen et al., 1990) that trigger gene-for-gene
resistance encode type III effector proteins that are
apparently delivered by bacteria to the plant cell via the
type III secretion system (Mudgett and Staskawicz, 1998;
Collmer et al., 2000; Kjemtrup et al., 2000; White et al.,
2000). Why would P. syringae inject Avr proteins into
Arabidopsis cells to trigger host resistance, thus inhibiting
bacterial growth? The likely answer is that avr genes
actually function as virulence genes when host plants do
not carry the corresponding R genes. In fact, virulence
functions of avrRpm1 and avrRpt2 on plants lacking the
RPM1 and RPS2 resistance genes, respectively, have
been demonstrated (Ritter and Dangl, 1995; Chen et al.,
2000; Guttman and Greenberg, 2001). Thus, a more
appropriate view of avr genes is probably that these are
virulence genes first evolved to promote bacterial
parasitism and that plants then counter-evolved
surveillance systems to recognize virulence gene-based
molecules (effectively turning virulence genes into
avirulence genes). When P. syringae injects these proteins
into Arabidopsis cells with the original purpose of
parasitizing the Arabidopsis cells, it does not “know” that
the recipient Arabidopsis cells may already be armed with
one or more corresponding R genes, which would turn
these virulence-intended proteins into defense elicitors-an
elegant example of the adaptive co-evolution of pathogen
virulence and plant resistance traits.
3. P. SYRINGAE ATTACKS AND ARABIDOPSIS
COUNTER-ATTACKS
Tremendous progress has been made in understanding
how Arabidopsis recognizes P. syringae Avr proteins and
The Arabidopsis Book 8 of 35
mounts effective defense against P. syringae. We now
know that the pathogen recognition and defense signal
transduction mechanisms underlying the Arabidopsis-P.
syringae interaction share many common features with
those observed in other Arabidopsis-pathogen
interactions. Readers are encouraged to consult several
excellent reviews on this topic (Glazebrook, et al., 1997;
Dong, 1998; Innes, 1998; Bent, 2001; Thomma, et al.,
2001; Glazebrook, 2001; Dangl and Jones, 2001;
Staskawicz et al, 2001). In addition, several chapters of
this book describe other Arabidopsis-pathogen systems or
discuss pathogen recognition and disease signal
transduction. We therefore will highlight only examples
that particularly illustrate either the important contribution
of using P. syringae as a model or the uniqueness of the
Arabidopsis-P. syringae system.
3.1. Pathogen avirulence and plant resistance in
incompatible Arabidopsis-P. syringae interactions
3.1.1. Gene-for-gene resistance in the Arabidopsis-P.
syringae system
Gene-for-gene incompatibility is prevalent among various
plant-pathogen systems and one of the best characterized
genetic relationships between plant hosts and pathogens.
The prevalence of gene-for-gene resistance and
similarities in associated responses among different plant-
pathogen systems strongly suggest common underlying
molecular mechanisms (Bent, 1996; Hammond-Kosack
and Jones, 1997) and, therefore, gene-for-gene resistance
was chosen to be the first target of study for the use of this
model system. To study gene-for-gene resistance, first, a
single avr gene was isolated by introducing a cosmid
library made from an avirulent strain into a virulent strain.
A cosmid clone containing an avr gene transformed the
virulent strain to an avirulent strain. Use of such a strain
carrying only a single avr gene created a situation in which
only a single gene-for-gene interaction was operating in
the plant-pathogen system. This step was crucial because
different combinations of avr and R genes are usually co-
dominant. For identification of corresponding R genes
after genetic isolation of avr genes, r- plants were identified
either by mutational analysis or by screens of various
ecotypes. Genetically isolated avr-R gene combinations
include avrRpt2-RPS2 (Kunkel et al., 1993; Yu et al., 1993),
avrRpm1 (or nearly identical avrPpiA1)-RPM1 (Dangl et al.
1992), avrB-RPM1 (originally called RPS3, but later shown
to be identical to RPM1) (Bisgrove et al., 1994), avrRps4-
RPS4 (Hinsch and Staskawicz, 1996), avrPphB (formerly
known as avrPph3)-RPS5 (Simonich and Innes, 1995), and
avrPphB-PBS1 (Warren et al., 1999).
Breakdowns in the narrowly defined version of the gene-
for-gene concept are seen here. The R gene RPM1
corresponds to two avr genes, avrRpm1 and avrB. The avr
gene avrPphB corresponds to two R genes, RPS5 and
PBS1. AvrRpm1 and AvrB are not homologous, neither
are RPS5 and PBS1. We should remember that the gene-
for-gene hypothesis was forwarded by Flor, based on the
study of flax-flax rust fungus interactions in the 1940s and
1950s (Flor, 1971), when knowledge about how genes
function at the molecular level was almost non-existent.
With the knowledge we currently have about molecular
interaction mechanisms, we can easily imagine a number
of possible molecular interaction models to explain these
situations, and we should interpret the gene-for-gene
concept more broadly. In a broader interpretation of the
gene-for-gene resistance, the key concepts should be that
a plant has pathogen recognition mechanism(s) composed
of a repertoire of genetically definable recognition
specificities and that pathogen recognition by these
mechanism(s) leads to a successful deployment of
defense responses in the plant.
3.1.2. R genes in the Arabidopsis-P. syringae system
All of the above-mentioned Arabidopsis R genes, RPS2,
RPM1, RPS4, RPS5, and PBS1, have been isolated by a
map-based cloning approach (Bent et al., 1994; Mindrinos
et al., 1994; Grant et al., 1995; Gassmann et al., 1999;
Warren et al., 1998; Swiderski and Innes, 2001). All but
PBS1 belong to the nucleotide binding site-leucine rich
repeat (NBS-LRR) class of R genes. The protein encoded
by an R gene of the NBS-LRR class has one NBS structure
that is located N-terminal to large imperfect LRRs, which
are located close to the C-terminus (Bent, 1996; van der
Biezen and Jones, 1998b). NBS-LRR is the dominating
class among the R genes so far isolated from dicots and
monocots (Ellis et al., 2000). Although each class member
usually has a high specificity to a particular pathogen of a
particular genotype (i.e., with the corresponding avr gene),
R gene members of this class collectively can confer
resistance against all major types of plant pests, namely
bacteria, oomycetes, fungi, viruses, nematodes, and
aphids. This fact provides strong molecular support to the
notion of common underlying mechanisms responsible for
many gene-for-gene resistance phenomena.
RPS2, RPM1, and RPS5 proteins have coiled-coil (cc)
structures (such as a leucine zipper) at their N-termini, and
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 9 of 35
are classified in the cc subclass of NBS-LRR (cc-NBS-
LRR). RPS4 has a TIR (for Toll and Interleukin-1 Receptor)
homology at its N-terminus, which is conserved among the
cytoplasmic domains of Drosophila Toll protein,
mammalian interleukin-1 receptors, and other NBS-LRR R
proteins (Whitham et al., 1994). Thus, RPS4 belongs to the
TIR subclass of NBS-LRR (TIR-NBS-LRR). Arabidopsis
ecotype Col has ~140 NBS-LRR genes in its genome,
including ~ 50 cc-NBS-LRRs and ~ 90 TIR-NBS-LRRs.
Although it is generally assumed that the role of most, if
not all, functional NBS-LRR genes is as R genes, it is not
known how many of these NBS-LRR genes are functional
R genes. It is conceivable that some of the NBS-LRR
genes might function as a reservoir of sequence materials
to create new recognition specificities through
recombination.
NBS-LRR proteins are believed to be intracellular, based
on computer predictions from their primary sequences.
RPS2 is not secreted or membrane-integrated in a
heterologous in vitro system (Leister et al., 1996). RPM1 is
peripherally associated with the plasma membrane (Boyes
et al., 1998). The plasma membrane localization of RPM1
seems appropriate because the corresponding Avr
proteins, AvrRpm1 and AvrB, are also localized at the
plasma membrane (Nimchuk et al., 2000). It is possible
that NBS-LRR proteins are localized at different subcellular
compartments in the cell for optimal detection of signal
molecules generated by the corresponding avr genes. For
example, it will be interesting to see whether there are any
NBS-LRR proteins localized in the nucleus to detect
nuclear-transported pathogen signal molecules.
PBS1 encodes a predicted cytoplasmic protein
serine/threonine kinase. The tomato R gene PTO (Martin
et al., 1993) is so far the only other example of an R gene
of the cytoplasmic protein kinase class. Both PBS1 and
the RPS5 NBS-LRR genes are required for resistance
against a P. syringae strain carrying avrPphB (Warren et al.,
1999). This combination of protein kinase and NBS-LRR
genes is reminiscent of the tomato R genes PTO (a protein
kinase gene) and PRF (NBS-LRR), both of which are
required for resistance against a P. syringae strain carrying
avrPto (Salmeron et al., 1996). Although PBS1 and PTO
belong to a large subfamily of plant protein
serine/threonine kinase genes, within the subfamily they
are not very closely related. It is likely that the substrate
specificities of these kinases are significantly different
(Warren et al., 1998).
3.1.3. avr genes in the Arabidopsis-P. syringae system
Although direct demonstrations are still lacking, all the
above-mentioned avr gene products, AvrRpt2, AvrRpm1,
AvrB, AvrRps4, and AvrPphB, are believed to be delivered
from bacteria into the plant cell via the type III secretion
system for the following reasons: (i) These avr genes
require type III secretion genes (called hrp/hrc genes in P.
syringae and other pathogenic bacteria) to express their
avirulence functions when P. syringae strains carrying avr
genes are inoculated into plants carrying the
corresponding R genes (Pirhonen et al., 1996; Gopalan et
al., 1996). (ii) Direct expression of these avr genes in the
plant cell leads to the HR, which is dependent on the
corresponding R genes (Alfano et al., 1997; Gopalan et al.,
1996; Leister et al., 1996; Scofield et al., 1996; Tang et al.,
1996; McNeillis et al., 1998; Stevens et al., 1998; Nimchuk
et al., 2000; Chen et al., 2000; Figure 5) – when expressed
in the plant cell, these Avr proteins are predicted to stay in
the cytoplasm. (iii) All but AvrRps4 seem to be modified in
the plant cell in a host cell-specific manner (Mudgett and
Staskawicz, 1999; Nimchuk et al., 2000). Again, it should
be emphasized that P. syringae stays outside of plant cells
(i.e., in the intercellular space) until plant cells start to
disintegrate at a very late stage of the interaction.
Host cell-specific modifications of Avr proteins are
Figure 5. The RPM1 resistance gene-dependent HR induced
by the expression of the P. syringae avrB gene directly in
Arabidopsis. Left panel: An Arabidopsis rps3-1 (an
rpm1mutant; Columbia background) seedling expressing
avrB under the 35S promoter. No HR is present. Right panel:
An F1 seedling from a cross between the rps3-1/avrB plant
and a wild-type Columbia plant (RPM1+). Arrow indicates
dark HR necroses on the cotyledon leaf. This seedling died
before true leaves emerged because of systemic develop-
ment of the HR.
The Arabidopsis Book 10 of 35
intriguing in the light of evolution of virulence/avirulence
factors – evolving mechanisms that are dependent on host
cell functions. AvrRpt2 protein is cleaved at a specific site
when it is incubated with plant cell extracts or when it is
directly expressed in the plant cell, whereas it is not
cleaved when produced in P. syringae or E. coli (Mudgett
and Staskawicz, 1999). The cleaving activity was not
detected in Arabidopsis intercellular fluids, so the cleavage
event is predicted to occur inside the plant cell. When a P.
syringae strain carrying avrRpt2 is inoculated into the leaf,
the inoculated tissue accumulates the cleaved form of
AvrRpt2. Therefore, AvrRpt2 seems to be transported into
the plant cell and specifically cleaved inside the cell.
AvrRpm1, AvrB, and the processed form of AvrPphB
(AvrPphB is rapidly cleaved when expressed in bacteria or
plants) have canonical eukaryotic acylation sequences at
their N-termini (Nimchuk et al., 2000). Mutations in the
potential N-terminal myristoylation sites in AvrRpm1 and
AvrB dramatically decreased their Avr activities when they
were delivered by P. syringae (it is not known whether the
mutations affected translocation of the proteins) or when
they were expressed in the plant cell. When the proteins
were expressed in the plant cell, they were myristoylated
and localized to the plasma membrane in a myristoylation
site-dependent manner. Because overexpression of the
Avr proteins in the plant cell can overcome the requirement
for the myristoylation site, myristoylation seems to be a
mechanism to increase the concentration of the protein at
the site of action, which is probably the intracellular side of
the plasma membrane. AvrPphB protein expressed in the
plant cell is cleaved and plasma membrane-localized in a
myristoylation site-dependent manner. This observation
demonstrates that proteins with canonical sites can be
myristoylated post-translationally and supports the notion
that proteins with canonical sites can be myristoylated
after they are delivered from bacteria via the type III
system.
3.1.4. Models for molecular mechanisms of gene-for-
gene relationships
We have yet to determine how Avr-based signals are
recognized by the R-mediated mechanism. Below we
discuss two popular hypotheses.
Two observations led to the ligand-receptor model (or
elicitor-receptor model) (Gabriel and Rolfe, 1990): (i) both
avr and R genes are usually dominant, and (ii) in most
cases, genetic single gene-single gene correspondence
can be seen. In this model: (i) an avr gene generates a
specific molecular signal (elicitor) directly (with the Avr
protein as the signal) or indirectly (e.g., Avr protein is an
enzyme that makes the signal molecule; Keen et al., 1990);
(ii) the corresponding R gene encodes the receptor for the
molecular signal; and (iii) this ligand-receptor interaction
initiates signal transduction to induce downstream
responses (Figure 6). Because the general concept of
specific interactions between ligands and the cognate
receptors has been known in biology for a long time, this
model is an intuitively obvious one. Although the R protein
in Figure 6 is depicted as a membrane receptor, the model
based on genetic relationships does not specify the nature
of the receptor, and the R protein could be an intracellular
receptor. If an Avr protein itself is the specific molecular
signal, this model predicts that the Avr protein and the
corresponding R protein physically interact. The P.
syringae AvrPto protein and the corresponding tomato Pto
protein interact in the yeast two-hybrid assay, and the
specificity for this interaction tightly correlates with the
specificity in their avr and R functionalities (Scofield et al.,
1996; Tang et al., 1996; Frederick et al., 1998). PTO
belongs to a rare R gene class of protein kinase genes.
The rice blast fungus Avr-Pita protein and the
corresponding rice Pi-ta R protein interact in the yeast
two-hybrid assay and in vitro (Jia et al., 2000). Pi-ta
belongs to the NBS-LRR class, although its LRRs do not
have a typical consensus sequence (Bryan et al., 2000).
These observations of physical interactions between Avr
and R proteins support the ligand-receptor model.
Although the ligand-receptor model is an obvious one, it
does not provide simple explanations to some
observations. (i) Plants do not have an efficient
mechanism to create new pathogen recognition
specificities and select good ones, compared with the
vertebrate adaptive immune system, in which somatic
recombination creates a vast repertoire of recognition
specificities and clonal selection provides a way to select
good specificities. Given this limitation, how can plants
Figure 6. The ligand-receptor model of R gene and avr gene
interaction. A specific signal molecule is directly or indirectly
generated by the avr gene in P. syringae. The signal mole-
cule is recognized by the receptor encoded by the corre-
sponding R gene in Arabidopsis. This moleuclar recognition
leads to rapid induction of defense response.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 11 of 35
have enough recognition specificities, which are limited by
the number of R genes in the genome, to effectively fend
off most potential pathogens, when pathogens, which are
in most cases microbes, can evolve much faster than
plants? For example, Arabidopsis has only ~140 NBS-
LRR genes. (ii) The same or very similar R genes can
confer resistance against very different types of
pathogens. The tomato Mi gene can confer resistance
against both nematodes and aphids (Rossi et al., 1998).
The potato Rx and Gpa2 genes confer resistance against
potato virus X and nematode, respectively, and are highly
homologous (Bendahmane et al., 1999; van der Vossen et
al., 2000). Similarly, the Arabidopsis RPP8 and HRT
genes, which are highly homologous, confer resistance
against the Peronospora parasitica and turnip crinkle virus,
respectively (McDowell et al., 1998; Kachroo et al., 2000).
How could molecular signals derived from very different
types of pathogens be recognized by the same or very
similar R genes? (iii) In many cases, cloned R genes
cannot function in different families of plants. The NBS-
LRR based mechanism, for example, apparently evolved
before major diversification of angiosperms. It is difficult to
imagine that the downstream mechanism has become
incompatible with the NBS-LRR upstream factors. (iv) Avr
proteins in general appear to be virulence factors when the
plant does not have the appropriate R genes. Is there any
reason that the factors to be recognized by plants as
signals of pathogen attack should have virulence functions
in nature?
To explain these phenomena, the “guard model” has
been put forward recently (van der Biezen and Jones,
1998a). According to this model: virulence factors
originating from pathogens have targets in the host to
express their virulence functions; the function of an R
protein is to guard such a target of a virulence factor;
when the target is attacked by the virulence factor, the R
protein somehow senses it and initiates signal
transduction to induce defense responses (Figure 7). The
guard model has been gaining popularity despite the lack
of directly supporting evidence, because it can provide
simple explanations to the above questions. (i) Assuming
that the number of targets for virulence factors is limited,
plants may not need to have a large number of R genes,
nor do they have to generate new specificities quickly. A
population genetic study of RPM1 alleles among
ecotypes supported the trench warfare hypothesis in the
evolution of avr and R genes, rather than the arms race
hypothesis (Stahl et al., 1999). The trench warfare
hypothesis images a battle between a host and its
pathogen in which one wins sometimes and loses other
times at the front line, but the overall situation does not
change drastically. The arms race hypothesis, on the
other hand, images a battle in which one acquires a new
weapon and almost eliminates the other, then the other
fights back with another new weapon. The RPM1 gene
was not defeated by the pathogen for a long time, and its
occurrence among the population fluctuates during this
time. This observation is consistent with the trench
warfare hypothesis and could be explained by assuming a
relatively limited number of potential virulence targets (so
that it is not easy for a pathogen to evolve a totally new
virulence factor) and a balance between benefit and cost
of resistance. (ii) If the same or very similar molecules are
targeted by virulence factors derived from different types
of pathogens (this situation is more likely to occur if the
number of potential virulence targets is limited), it is
conceivable that the same or very similar R proteins can
guard the same or very similar virulence target molecules.
(iii) A combination of a virulence factor target and the
guarding R protein can co-evolve and drift, so that it is
conceivable that after some evolutionary time, partners in
orthologous combinations in different taxa of plants
become unexchangeable. (iv) That virulence factors are
the molecules to be recognized as signals of pathogen
attack is a built-in assumption of the model.
From the viewpoint of molecular recognition
mechanisms, the guard model appears to be a small
extension of the ligand-receptor model. The combination
of the virulence factor target and the R protein can be
considered as a receptor complex. However, the guard
model adds more restrictions in this figure from the
viewpoint of biological functions – the ligand must be
intrinsically a virulence factor, and the receptor complex
must contain the virulence factor target in addition to the R
Figure 7. The guard model of R gene and avr gene interac-
tion. When a plant does not have an appropriate R gene (r-
background; left), a virulence factor derived from P. syringae
interacts with the plant virulence target molecule. The viru-
lence target molecule has a role in defense response induc-
tion in the plant cell, and this function is inhibited by the
interacting virulence factor. When a plant has the appropriate
R gene (R+ background; right), the virulence target is guard-
ed by the R protein. When the target is attacked by the viru-
lence factor, the R protein senses the attack and rapidly
induces defense response.
The Arabidopsis Book 12 of 35
protein. These restrictions are the reason that the guard
model can provide the above simple explanations.
The result from co-immunoprecipitation of AvrRpt2 and
RPS2 after expressing the proteins in Arabidopsis
protoplasts was consistent with the notion of receptor
complex (Leister and Katagiri, 2000). They were co-
immunoprecipitated together with some other plant
proteins from the plant extracts; they were not co-
immunoprecipitated by themselves in vitro. However, this
study does not tell whether the other complex
components are necessary for gene-for-gene recognition,
or whether one of the components is the AvrRpt2 virulence
factor target.
3.1.5. Other genes involved in gene-for-gene
resistance
A few Arabidopsis genes in which mutations affect a group
of R gene-mediated resistance are known. A mutation in
NDR1 strongly affects resistance mediated by some cc-
NBS-LRR R genes, whereas a mutation in EDS1 strongly
affects resistance mediated by TIR-NBS-LRR R genes
(Aarts et al., 1998). The most simple-minded model is that
cc-NBS-LRR and TIR-NBS-LRR use different signal
transduction pathways, and NDR1 and EDS1 are signal
transducers in each pathway. For gene-for-gene
resistance against P. syringae, resistance mediated by cc-
NBS-LRRs (namely RPS2, RPM1, and RPS5 R genes) is
affected by the ndr1mutation but not much by the
eds1mutation, whereas resistance mediated by the RPS4
TIR-NBS-LRR is affected by eds1 and not by ndr1. This
does not conflict with the model if we assume both
pathways can independently induce a set of defense
responses that are important for resistance against P.
syringae. Alternatively, these pathways may induce two
different sets of defense responses, and both sets are
effective against P. syringae. However, there are many
other simple models to explain the behavior of ndr1 and
eds1 mutations. In addition, there is no reason to believe
that NDR1 and EDS1 have comparable positions in the
sequence of events. For example, these proteins might be
needed to produce functional R proteins in a subclass-
specific manner (e.g., modification, localization); one of
them might be affecting pathogens directly but show
differential effects due to differences in the sensitivity of R-
mediated recognition (the other functions in a different
way); in the guard model, they might be the targets of
multiple virulence factors, guarded by multiple R proteins.
It should be emphasized that the effects of ndr1 and eds1
mutations on R gene-mediated resistance are not always
clear-cut. For example, RPS2-mediated resistance is
strongly suppressed by the ndr1 mutation, but RPM1-
mediated resistance is only partially suppressed (Century
et al., 1995). NDR1 might be a quantitative factor for NBS-
LRR R gene functions (Tao et al., 2000).
A mutation in PBS2 affects resistance mediated by
RPS2, RPM1, and RPS5, but does not affect resistance
mediated by RPS4. Within this set of R genes, it appears
that pbs2 suppresses cc-NBS-LRR mediated resistance,
although a larger set of R genes needs to be tested to
obtain a general conclusion about the R gene subclass
specificity. There are also NBS-LRR genes whose
functions are independent of any of NDR1 , EDS1 , PAD4,
and PBS2 (Bittner-Eddy and Beynon, 2001). Some of such
complications could stem from a signal transduction
network (involving not only divergent pathways but also
convergent pathways) and quantitative dynamics of the
network.
3.2. General resistance in the Arabidopsis-P. syringae
interaction
Here we use the term “general resistance” as resistance
that contributes to reduction in growth of virulent and
avirulent pathogens to a similar extent. As you will see in
this section, even the growth of a virulent pathogen is
limited by general resistance of the plant. Note that the
growth of an avirulent pathogen is limited by the gene-
for-gene resistance in addition to general resistance.
Even when the gene-for-gene resistance component is
intact, a defect in general resistance component may
allow an avirulent pathogen to grow well enough to cause
disease symptoms. But in this case, without the gene-
for-gene resistance component, the pathogen would
grow even better.
3.2.1. General resistance against virulent P. syringae:
a new view of compatible Arabidopsis-P. syringae
interactions
Establishment of a genetic model plant-pathogen system
opened up new areas of experiments, some of which
ended up challenging dogmas. One new area of
experimentation is intensive plant mutant screens under
well-controlled conditions: because Arabidopsis plants are
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 13 of 35
small, mutant screens can be performed in growth
chambers (even when you don’t have access to a large
volume of growth chamber space) instead of greenhouses.
Well-controlled conditions are crucial in reproducibility of
subtle phenotype differences. This is especially important
because plant-pathogen interactions are often significantly
affected by environmental factors and the developmental
stage of the plants. One subtle phenotype difference that
was pursued was the difference in the degree of disease
symptoms during compatible interactions (Glazebrook et
al., 1996). Mutational analysis of Arabidopsis in response
to virulent P. syringae strains led to identification of
Arabidopsis mutants (e.g., npr1, eds, pad4; see below) that
show enhanced disease susceptibility to normally virulent
P. syringae strains (Glazebrook et al., 1997b). These
Arabidopsis mutants are impaired in the activation of
defense responses during compatible interactions. A
long-held dogma in plant pathology textbooks led people
to believe that incompatible and compatible interactions
are qualitatively different. The idea was that plants are
susceptible to certain pathogens because they simply
cannot mount a resistance response to the pathogens.
However, studies on these mutants unambiguously
demonstrated that even when they are susceptible to a
pathogen, plants defend themselves to slow down the
pathogen-but the general defense is not effective enough
to completely stop the pathogen.
This change of the view of compatible interactions also
raises a question about whether the distinction between
compatible and incompatible interactions is necessarily
correlated with differences in the underlying molecular
mechanisms. One can easily imagine the following
situation: each plant has a pool of R genes with different
affinities that detect various P. syringae Avr proteins. The
affinity will be highest if an Avr protein is perceived by a
cognate R gene in a resistant plant and is responsible for
induction of an effective defense. Although a susceptible
plant lacks the cognate R gene to recognize an “Avr-like”
protein of a virulent P. syringae strain, some R genes in the
susceptible plant may still weakly “interact” with one or
more of these ”Avr-like” proteins produced by the virulent
P. syringae strain, so the resistance pathway is activated,
but too slowly and/or too weakly to completely stop the
virulent P. syringae infection. Nevertheless, loss-of-
function mutations in these “weak” R genes or resistance
signaling component genes would increase the
susceptibility of the plant to virulent P. syringae. In short,
compatible/incompatible interactions may not be
determined by distinctive molecular mechanisms, but by
quantitative or kinetic variations in the same molecular
mechanism. We should be aware that traditional
classification of biological phenomena may not be
correlated with distinctive molecular mechanisms.
An interesting observation is that some Arabidopsis
mutations initially identified based on defects in gene-for-
gene resistance against avirulent pathogens also affect
general resistance against virulent pathogens or vice
versa. For example, virulent Pst DC3000 grows better in
the eds1 mutants, which were initially identified in screens
for gene-for-gene interaction mutants (Aarts, et al., 1998).
Mutations in PAD4 were identified initially by reduced
general resistance, but pad4 affects some R gene-
mediated resistance and general resistance to P. syringae
(Glazebrook, et al., 1997b). When expressed in the plant
lacking RPS2, the virulence function of AvrRpt2 affects
both general resistance to virulent DC3000 and specifically
RPM1-mediated gene-for-gene resistance (Chen, et al.,
2000). These observations suggest that R-mediated
resistance and general resistance against virulent
pathogens are closely related. Responses to virulent
strains might use both EDS1- and PAD4- dependent
pathways, if EDS1 and PAD4 are indeed signal
transducers. Furthermore, recognition of virulent strains
might even use NBS-LRR type proteins but the response
could be slower and/or weaker. In the guard model, the
pathogens’ virulence factors may attack some molecular
components for general resistance and resistance
mediated by R proteins that guard the particular
components could also be affected.
3.2.2. Role of SA in general resistance and gene-for-
gene resistance to P. syringae
Genes that contribute to general resistance against P.
syringae and P. parasitica appear to be mainly involved in
the SA-dependent signaling pathway for defense response
regulation. Mutations in all such genes (e.g., EDS and
PAD4; Aarts et al., 1998; Glazebrook et al., 1997b), except
for NPR1 and DTH9, reduce SA accumulation during
pathogen attack (Glazebrook, 2001). NPR1 seems to be a
signal transducer downstream of SA (Delaney et al., 1995;
Cao et al., 1994; Kinkema et al., 2000). Studies that
involve plants that carry the NahG transgene (encoding
salicylate hydroxylase which degrades SA) and general
resistance mutants clearly indicate that the SA-dependent
pathway is crucial for general resistance against many
pathogens including P. syringae. Furthermore, many
pathogen-responsive genes are regulated in a SA-
dependent manner. SA is accumulated at a higher level
during incompatible interactions than during compatible
interactions at early stages of interaction. The SA-
dependent pathway might be the link between general
resistance and gene-for-gene resistance. However, the
role of SA in gene-for-gene resistance is not that clear.
The Arabidopsis Book 14 of 35
NahG plants can develop an HR upon infection of avirulent
bacteria. They are not strongly affected in the gene-for-
gene resistance mediated by at least some R genes,
whereas the general resistance component is strongly
impaired (Delaney et al., 1994). It should be noted that not
only is SA a major signal transducer after recognition of
pathogen attack, but it also can potentiate pathogen
recognition sensitivity at a low level (Shirasu et al., 1997).
One role of SA in gene-for-gene resistance may be to
potentiate the recognition mechanism. In this way, only
gene-for-gene interactions with relatively low sensitivities
might be strongly affected by a lower SA level.
3.2.3. Role of JA and ethylene in general resistance to
P. syringae
In addition to the SA-dependent pathway, involvement of
the JA/ethylene-dependent pathway in general defense
has been observed. In many cases, the SA-dependent
pathway and the JA-dependent pathway act
antagonistically (Felton et al., 1999a, 1999b; Pieterse and
van Loon, 1999; Thomma et al., 2001). Activation of the
JA-pathway could suppress the SA-pathway and reduce
general resistance against pathogens, such as P. syringae,
against which plants mainly use the SA-pathway. In fact,
some virulent P. syringae strains appear to use this
antagonistic interaction to suppress Arabidopsis defense
(see section 4.2.1). However, the JA/ethylene pathway, not
the SA pathway, is important for induced systemic
resistance (ISR), which causes resistance against virulent
P. syringae strains (see section 3.5). Whereas in many
cases JA and ethylene appear to function in concert,
ethylene response seems to be important for general
resistance or tolerance against virulent P. syringae (Ton et
al., 1999a; 1999b; Bent et al., 1992). The interactions
among SA-, JA-, and ethylene-dependent pathways do
not appear to be simple. Complications could arise from
different roles of these pathways in different stages of
plant-pathogen interactions. Therefore, it will be important
to obtain various measurements of a given interaction with
high spatial and temporal resolution.
3.3. What defense responses are responsible for
Arabidopsis resistance to P. syringae?
We have very limited knowledge about which particular
defense responses are important for resistance against P.
syringae or any other pathogen. Phytoalexins are known
to be involved in pathogen resistance in some
pathosystems (Hammerschmidt and Dann, 1999). The
Arabidopsis PAD3 gene encodes a P450 monooxygenase,
which is likely to be one of the enzymes required for
synthesis of the Arabidopsis phytoalexin camalexin (Zhou
et al., 1999). A mutation in this gene abolishes camalexin
accumulation after infection by P. syringae but does not
affect other tested defense responses (Glazebrook and
Ausubel, 1994). General and gene-for-gene resistance
against P. syringae is not significantly affected in the pad3
mutant (Glazebrook and Ausubel, 1994), whereas general
resistance against the fungus Alternaria brassicicola is
reduced in the pad3 mutant (Thomma et al., 1999).
Although camalexin exhibits toxicity to P. syringae in vitro
(Rogers et al., 1996), it is likely that camalexin does not
have a major contribution to resistance against P. syringae
in Arabidopsis. We should, however, keep in mind that
resistance to a given pathogen is likely to be composed of
complex combinations of different defense responses.
Some responses may act additively, some may act
synergistically, and some may be functionally redundant.
We may not detect an effect of loss of a redundant
function. Reactive oxygen species, PR proteins, and host
cell wall modification are additional candidate defense
compounds/mechanisms, but none of them have so far
been linked directly to P. syringae resistance in vivo.
3.4. Systemic resistance responses
An initial localized infection of an avirulent P. syringae
strain causes plant cell death (an HR in this case), which
could further trigger a whole-plant level of relatively weak
resistance against secondary infection by a broad range of
pathogens, including normally virulent strains of P.
syringae (Ryals et al., 1996). This phenomenon is called
systemic acquired resistance, or SAR (see chapter by
Dangl for details). SA accumulation in the systemic
tissues is essential for SAR, but SA is unlikely to be the
long-distance signal that initiates SAR in the uninfected
parts of the plant (Vernooij et al., 1994). Because the SA-
dependent mechanism is also crucial for local gene-for-
gene and general defense, many Arabidopsis mutants
isolated based on their deficiency in local defense against
pathogens have defects in the SA signaling pathway and
are also deficient in SAR (Glazebrook et al., 1997a). The
level of SA accumulated in the infected local tissues is
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 15 of 35
much higher than that in the systemic tissue. It seems that
plants use the same SA pathway at different degrees for
local defense and for defense in systemic tissues in SAR.
This would be a very practical solution for plants because
(i) plants would not have had to evolve two distinct
signaling pathways for two purposes and (ii) full-blown
activation of the SA pathway appears deleterious not only
to pathogens, but also to the plant itself, as suggested by
growth defects among plant mutants that have the SA
pathway constitutively on.
3.5. Rhizobacteria-mediated induced systemic
resistance (ISR)
Before we leave the subject of P. syringae resistance, we
would like to mention an interesting systemic resistance
mechanism that is effective against P. syringae, but is
mechanistically distinct from SAR described above. This
resistance mechanism is called induced systemic
resistance (ISR) and is triggered by non-pathogenic, root-
colonizing rhizobacteria, such as Pseudomonas
fluorescens strain WCS417r or P. putida strain WCS358r
(Pieterse et al., 1996). In contrast to pathogen-induced
SAR, ISR is not associated with SA accumulation or
activation of PR genes. Jasmonic acid and ethylene
appear to play an important role in this SA-independent
pathway (Pieterse et al., 1998; Knoester, 1999). The
Arabidopsis jasmonate response mutant jar1 and the
ethylene response mutant etr1, which show a normal
response to inducers of SAR, are unable to express ISR
after root treatment with P. fluorescens WCS417r. Although
ISR and SAR seem to follow distinct signaling pathways,
they are both blocked in the npr1 mutant (Pieterse et al.,
1998). Thus, the NPR1 protein is not only required for the
SA-dependent expression of PR genes that are activated
during SAR, but also for the jasmonate- and ethylene-
dependent activation of so-far-unidentified defense
responses resulting from ISR. Because the expression of
none of the SAR-associated or jasmonate/ethylene-
induced genes is affected during ISR, ISR is believed to be
associated with an increase in Arabidopsis sensitivity to
the defense hormones JA and ethylene (van Wees et al.,
1999, 2000).
4. Pathogen virulence and host susceptibility in the
compatible Arabidopsis-P. syringae interactions
In the preceding section, we discussed how Arabidopsis
recognizes and defends against P. syringae infection. What
happens when Arabidopsis fails to rapidly recognize a P.
syringae strain, due to lack of appropriate R genes? How
do Arabidopsis plants become susceptible to virulent P.
syringae strains? What is the molecular basis of P.
syringae pathogenicity? To be a successful extracellular
pathogen, virulent P. syringae (e.g., strain DC3000 in
Arabidopsis ecotype Columbia) must evolve an array of
pathogenic mechanisms to suppress or evade Arabidopsis
defense responses that are apparently effective in
preventing virulent infection by the vast majority of
potential parasites. It must also develop mechanisms to
release nutrients and water to the apoplast, where bacteria
live. How P. syringae succeeds in doing this is not known.
However, molecular genetic analysis of P. syringae
pathogenicity has revealed two virulence systems that play
an important role in P. syringae infection of plants: the type
III protein secretion system and a toxin called coronatine.
4.1. Pathogen virulence
4.1.1. The type III protein secretion system: A key
pathogenicity factor in P. syringae
The type III protein secretion system was discovered first
in the human pathogens Yersinia spp., but has now been
found to be widespread among Gram-negative bacterial
pathogens of plants and animals (He, 1998; Hueck, 1998;
Galan and Collmer, 1999; Cornelis and Van Gijsegem,
2000). The most intriguing feature of this protein secretion
system is the ability of this system to actively inject
bacterial virulence proteins directly into host cells. The
importance of the type III secretion system in P. syringae
pathogenicity is underscored by the observation that
hrp/hrc mutations that block type III secretion completely
eliminate P. syringae infectivity in susceptible Arabidopsis
plants (Roine et al., 1997). The ability of P. syringae to
inject virulence proteins directly into the host cell is
believed to be highly significant in pathogen evolution,
because this injection mechanism enables the pathogen to
gain access to a vast number of intracellular host targets
that would not be available for bacterial virulence proteins
delivered to the surface of host cells. As mentioned in
section 3.1.3, in P. syringae and other plant bacterial
pathogens, the majority of the known type III effectors are
Avr proteins, which are identified based on their ability to
trigger resistance responses following recognition by the R
gene products in the incompatible interactions. How P.
The Arabidopsis Book 16 of 35
syringae delivers Avr and other type III effector proteins
from its cytoplasm to the host cell cytoplasm is not known.
However, a P. syringae surface pilus (called the Hrp pilus)
assembled by the type III secretion system has been
shown to play a key role in this process, possibly by
providing a bridge for protein transfer (Roine et al., 1997;
Wei et al., 2000; Hu et al., 2001; Jin et al., 2001).
With the DC3000 genome sequencing project near
completion (http://www.tigr.org/tdb/mdb/mdbinprogress.html),
several groups are addressing a pressing question: how
many type III effectors are produced by this bacterium?
Two strategies of systematic search for type III effectors
are underway. First, all known type III effector genes in P.
syringae contain a characteristic ‘hrp-box’ motif in their
promoters (Shen and Keen, 1993; Innes et al., 1993; Xiao
et al., 1994). Therefore, a BLAST search using the
consensus ‘hrp-box’ motif should identify putative type III
effector genes. Second, a type III secretion reporter
system has been developed. A truncated AvrRpt2 protein
lacking the N-terminal type III secretion signal but
maintaining HR-eliciting activity once inside RPS2+
Arabidopsis cells (Mudgett et al., 2000; Guttman and
Greenberg, 2001) can be used to generate random fusions
in the DC3000 genome. An in-frame fusion of the N-
terminal secretion signal of a type III effector with the
truncated AvrRpt2 reporter will target the fusion protein
into Arabidopsis cells to trigger an AvrRpt2/RPS2-
dependent HR. With a combination of these two
strategies, we shall soon know the exact number of type III
effectors in DC3000.
How do type III effectors function inside the host cell to
promote plant susceptibility? This has been a major
mystery in the field of plant-pathogen interactions. To
date, no plant ‘susceptibility’ pathway has been clearly
identified in any plant-bacteria interaction. In animal-
pathogen interactions, increasing evidence suggests that
the MAP kinase defense pathway (Orth et al., 1999),
delivery of reactive oxygen-generating enzymes (Vazquez-
Torres et al., 2000, 2001; Feng et al., 2001; Vazquez-Torres
and Fang, 2001), ubiquitin-like molecules (Orth et al.,
2000), and actin cytoskeleton (Galan and Zhou, 2000) in
the host are the targets of type III virulence proteins,
demonstrating that type III effectors are ‘smart bombs’
sent by pathogens. Unfortunately, the primary sequences
of the identified P. syringae type III effector genes provide
little clue to their functions in modulating plant signaling
and metabolic processes. In Xanthomonas spp., however,
there are some clues to the functions of several Avr
proteins in compatible hosts. For example,
AvrRxv/AvrBsT from X. campestris pv. vesicatoria shares
sequence homology with YopJ/P of Yersinia and AvrA of
Salmonella (Orth et al., 2000). YopJ is a MAP kinase
pathway inhibitor that suppresses macrophage defenses
and appears to have protease activity (Orth et al., 1999,
2000). Whether AvrRxv and AvrBsT target a MAP kinase
pathway for their virulence functions in susceptible host
plants is not known, but the putative protease activity of
AvrBsT appears to be required for elicitation of plant
resistance response (Orth et al., 2000). AvrBs2 shows
similarity with agrocinopine synthase (opine production in
tumors) of Agrobacterium tumefaciens, suggesting a
possible (but not proven) role in the nutrition of the
pathogen (Swords et al., 1996). AvrBs3 family members,
which are widespread in pathogenic Xanthomonas spp.,
appear to be transcription factors, although the host genes
directly transcribed by the AvrBs3 family proteins remain
to be identified (Bonas et al., 1989; Yang and Gabriel,
1995; Zhu et al., 1998; Zhu et al., 1999; Yang et al., 2000).
It is almost certain that a major function of P. syringae
type III effector proteins is to suppress plant defense
responses in the host. Supporting evidence is
accumulating. For example, hrp mutant bacteria appear to
induce the expression of several general defense-
associated genes, such as phenylalanine ammonia lyase
and chitinase genes (Jakobek et al., 1993), and papillae
formation (Bestwick et al., 1995; Brown et al., 1995),
whereas the wild-type strains suppress expression of
these defense genes and formation of papillae. There is
also bacterial genetic evidence that some avr gene
products, including AvrRpt2, interfere with the function of
other avr gene products in the elicitation of host resistance
(Ritter and Dangl, 1996; Reuber and Ausubel, 1996;
Jackson et al., 1999; Chen et al., 2000; Tsiamis et al.,
2000). An increasingly popular idea, as discussed in the
guard model (Figure 7), is that type III effectors, including
Avr proteins, may target key components of general
defense in susceptible plants, presumably to suppress
host defense. However, the exact molecular mechanisms
by which type III effectors modulate the plant resistance
responses remain to be elucidated.
Experiments involving heterologous expression of avr
genes inside plant cells suggest that Avr proteins can be
deleterious even in the absence of a known cognate R
gene if expressed too strongly (Gopalan et al., 1996;
McNeillis et al., 1998; Nimchuk et al., 2000). Whether these
effects result from interaction with susceptibility targets in
the host is unknown. However, the sensitivity of
Arabidopsis to AvrB over-expressed in the susceptible
plant cell depends on a single gene, which suggests that a
specific plant target is involved in this phenomenon
(Nimchuk et al., 2000). As extracellular pathogens, P.
syringae and other bacterial pathogens must also cause
host cells to release water and nutrients into the apoplast.
Consequently, some type III effectors may be involved in
water and nutrient release (Figure 8). Despite these
accumulating clues, in no case has a specific plant
‘susceptibility’ target been identified for any type III
effector in plant pathogenic bacteria. Identification of host
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 17 of 35
susceptibility targets/pathways is therefore a major
challenge in the field.
4.1.2. The coronatine toxin-A molecular mimic of
methyl jasmonate
In addition to the type III secretion system, strains DC3000
and ES4326 also produce a toxin (called coronatine) that
plays a significant role in modulating host susceptibility
(Bender et al., 1999). However, unlike mutations affecting
the type III secretion system, mutations affecting
coronatine production do not completely eliminate
pathogen virulence in susceptible Arabidopsis plants,
rather they have only a quantitative effect on pathogen
virulence, most notably coronatine-deficient bacterial
mutants cause substantially weaker disease symptoms
(chlorosis and necrosis) and a subtle reduction of bacterial
multiplication in host leaves (Bender et al., 1987; Mittal and
Davis, 1995).
The structure of coronatine (Figure 9) has two distinct
components: the polyketide coronafacic acid (CFA) and
coronamic acid (CMA), an ethylcyclopropyl amino acid
derived from isoleucine. The primary symptom elicited by
coronatine in plants is tissue chlorosis (Gnanamaickam et
al., 1982). However, exogenously applied coronatine
induces purpling of Arabidopsis leaves (Bent et al., 1992),
presumably resulting from anthocyanin production.
Coronatine also inhibits root elongation and stimulates
ethylene production in plants (Ferguson and Mitchell,
1985; Kenyon and Turner, 1992; Feys et al., 1994).
Coronatine bears remarkable structural and functional
homologies to methyl jasmonate (MeJA). Furthermore,
coronatine and MeJA induce similar biological responses
in Arabidopsis seedlings (Feys et al., 1994) and other
plants (Weiler et al., 1994; Greulich et al., 1995; Koda et al.,
1996), leading to the suggestion that coronatine functions
as a molecular mimic of MeJA. MeJA accumulates in
response to wounding or insect chewing and is involved in
a systemic defense response to invading insects via
production of defense compounds, including proteinase
inhibitors (Ryan and Pearce, 1998). Why would bacteria
produce a toxin whose function mimics that of MeJA? As
mentioned above, coronatine-deficient DC3000 mutants
have reduced virulence in susceptible Arabidopsis, so one
must hypothesize that coronatine somehow conditions
host plants to be more susceptible for bacterial infection
via activation of the JA signaling pathway. Emerging
evidence suggests that the JA-mediated insect defense
and SA-controlled pathogen resistance are sometimes
antagonistic to each other so that activation of one
pathway leads to inhibition of the other (Felton et al.,
1999a, 1999b; Pieterse and van Loon, 1999; Thomma et
al., 2001). This has been interpreted as plants prioritizing
energy-consuming defense responses towards specific
insults (e.g., insects vs. some microbial pathogens). If this
is true, coronatine could act as a suppressor of the plant’s
SA-dependent microbial defense system by triggering JA-
mediated insect defense response. Consistent with this
idea, a study shows that a coronatine mutant of DC3000
induces the expression of two pathogen defense-
associated genes (phenylalanine ammonia lyase and
Figure 8. A hypothetical model of the potential targets of
type III effector proteins in the host cell. P. syringae is an
extracellular pathogen, living and multiplying in the leaf
apoplast. Some effector proteins must therefore be involved
in releasing water, carbohydrates and other nutrients from
the host cell. Other effector proteins are likely involved in
suppressing or evading host defense responses. In the top
right corner is a scanning electron microscopic image of a
cross section of an Arabidopsis leaf infected with DC3000
(see Figure 4).
Figure 9. The structure of coronatine.
The Arabidopsis Book 18 of 35
glutathione S-transferase) more highly than wild-type
DC3000 (Mittal and Davis, 1995). However, we have yet to
resolve the precise mechanism by which coronatine tricks
Arabidopsis and other plants to turn on the JA pathway
and to presumably inhibit effective plant defense against P.
syringae. Remember that ISR against P. syringae is
actually dependent on the JA pathway components (see
section 3.5). How can the same pathway be involved in
processes leading to opposing effects on P. syringae
resistance/susceptibility?
4.2. Host susceptibility
4.2.1. Arabidopsis coi1 mutant-Blocking the action of
the coronatine toxin
Based on the ability of coronatine to inhibit Arabidopsis
root growth, Feys et al. (1994) isolated a coronatine-
insensitive (coi1) mutant of Arabidopsis. Interestingly, the
same mutant is also insensitive to MeJA, further
suggesting a similar mode of action of coronatine and
MeJA. Consistent with the role of coronatine in the
virulence of toxin-producing P. syringae strains, the coi1
mutant plants are highly resistant to P. syringae pv.
atropurpurea (Feys et al., 1994), and pv. tomato DC3000
(Kloek et al., 2001; R. Thilmony and S. Y. He, unpublished),
with markedly reduced disease symptoms and bacterial
multiplication. However, the coi1 mutant has increased
susceptibility to insects and certain necrotrophic fungal
pathogens and is male sterile (Feys et al., 1994; Thomma
et al., 1998). At present, it is not known how the same
COI1 protein participates in seemingly different pathways
leading to pathogen defense/susceptibility and pollen
development. The COI1 protein belongs to a family of
conserved proteins (e.g., human Skp2 involved in cell
division, yeast Grr1 involved in cell division and nutrient
uptake, and Arabidopsis TIR1 involved in auxin response)
that contain an F box and leucine-rich repeats (Xie et al.,
1998). Proteins of this family are known to be involved in
selectively recruiting substrate regulatory proteins (e.g.,
transcription repressors) into a complex for ubiquitination
and subsequent removal by proteolysis (Latres et al., 1999;
Spencer et al., 1999; Spiegelman et al., 2001). Thus, the
COI1 protein could control pathogen defense responses
and pollen development by targeting distinct repressors
for degradation in different cell types and possibly in
response to different signals.
Recently, Barbara Kunkel’s lab isolated additional alleles
of the coi1 mutant from a direct screening for Arabidopsis
mutants with enhanced resistance (Kloek et al., 2001).
They made the important finding that DC3000 resistance
(restriction of DC3000 multiplication) in the coi1 plants is
largely abolished when the coi1 plants are crossed to SA-
deficient nahG plants. These results suggest that the
inhibition of DC3000 multiplication in the coi1 mutant is
dependent on accumulation of SA. Perhaps the coi1
plants can mount a more aggressive SA-mediated
pathogen defense in the absence of the otherwise
antagonistic JA defense pathway. Interestingly the
coi1nahG plants still show less severe disease symptoms
than wild-type plants after DC3000 infection. This
observation argues that the COI1 protein is required for
DC3000-induced symptom development, in addition to its
involvement in cross-talk with the SA-mediated defense
pathway.
Compared with the bacterial cor- mutant phenotype, the
Arabidopsis coi1 mutant phenotype is much more drastic,
suggesting that lack of perception of coronatine is not the
only defect in the coi1 mutant. Specifically, whereas
DC3000 multiplies about 100-fold less in coi1 plants
(compared with in wild-type Col plants) and causes no
disease symptoms when 106 cfu/ml of DC3000 are
infiltrated into leaves, DC3000 cor- mutants multiply
similarly as the wild-type bacteria in Col plants (at most, a
10-fold reduction) and still cause some disease symptoms,
albeit at a lower frequency (Kloek et al., 2001; R. Thilmony
and S. Y. He, unpublished results). COI1 could be
required for the action of additional DC3000 virulence
factors. One possibility is that some type III effectors also
target a COI1-dependent pathway to modulate host
susceptibility, which, if proven, could assign a major host
target for P. syringae type III effectors. Alternatively,
coronatine may activate only a subset of COI1-dependent,
SA-antagonistic pathways, whereas the coi1 mutation may
eliminate all COI1-mediated, SA-antagonistic pathways.
As discussed in section 3.2, a variety of other
Arabidopsis mutants also influence susceptibility to
virulent P. syringae infection via their effects on general
defense in the plant. Some mutants have increased
susceptibility owing to a block in the accumulation or
perception of SA (e.g., npr1, eds, ndr1, pad4, eds5, sid2);
others have enhanced resistance owing to constitutive
expression of SA and defense genes (e.g., cpr, dnd, acd,
lesion mimic mutants, MAP kinase mutants; see chapter
by Dangl). A key distinction between the Arabidopsis coi1
mutant and these other Arabidopsis mutants is that we
know that the COI1 pathway is the target of a known P.
syringae virulence factor (coronatine). As we continue to
unravel the host components targeted by the DC3000
virulence factors, it would not be surprising to learn that
some of the known Arabidopsis defense pathway
components are additional targets of DC3000 virulence
factors during compatible interactions. This prediction is
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 19 of 35
in line with the adaptive co-evolution theory that both plant
and pathogen evolve to overcome each other’s lethal
weapons, and with the guard model of R gene/avr gene
interaction.
5. ARABIDOPSIS AND P. SYRINGAE GENOMICS
In addition to the genetic tractability of both host and
pathogen genomes, the Arabidopsis-P. syringae
pathosystem now offers another advantage: rapidly
accumulating genomics resources. Completion of
Arabidopsis genome sequencing in 2000 (The Arabidopsis
Genome Initiative, 2000) and expected completion of the
P. syringae pv. tomato DC3000 genome sequencing in
2002 (http://www.tigr.org/tdb/mdb/mdbinprogress.html)
are making the Arabidopsis-P. syringae system an
attractive genomics-amenable system. Powerful
structural, computational, and functional genomics
approaches can be used to examine this interaction in
ways that cannot yet be done with many other
pathosystems. For example, genome-wide monitoring of
changes in gene, protein, and metabolite expression will
give us a global picture of the intricate cross-talk among
interconnecting signaling and metabolic pathways during
the Arabidopsis-P. syringae interaction. Knowledge of
host and pathogen genomes will also facilitate systematic
mutational analysis of host and pathogen determinants
involved in incompatible and compatible interactions.
5.1. Host genomics
Analysis of the Arabidopsis genome has identified
hundreds of genes that show significant sequence
similarities with known disease resistance genes, disease
signal transduction components, and downstream
defense response genes, confirming the belief that
Arabidopsis (and likely other plants) devotes a substantial
portion of its genome to combating pathogens. Some of
these genes likely encode additional recognition
components of distinct specificities, checkpoints of sub-
branches of disease signaling pathways, and redundant
defense substances. They represent a rich resource for
discovery of new genes controlling Arabidopsis-P. syringae
interactions.
Global gene expression profiling is already an
established technology for Arabidopsis (Zhu and Wang,
2000). It has been used in the study of host gene
regulation in interaction with P. syringae. One of the
discoveries made by Maleck et al. (2000) is that many of
the genes regulated by DC3000/avrRpt2 in the systemic
leaves clustered with genes regulated by Peronospora
parasitica and also by the SA analog BTH (within the first 4
h), suggesting that the DC3000/avrRpt2-induced SAR is
transcriptionally related to P. parasitica-induced SAR and
to an early phase of BTH-induced SAR (Maleck et al.,
2000). The inclusion of the DC3000/avrRpt2 treatment in
this study thus helped to sort out the biologically relevant
transcripts that are strongly associated with SAR. The
identified novel SAR-associated genes are candidates for
further study using functional genomics approaches.
5.2. P. syringae genomics
At the writing of this edition, the DC3000 genome
(approximately 6.2 mb) has not been annotated
completely. However, even the incompletely annotated
DC3000 genome is giving us an opportunity to perform
many specific analyses. For example, a Blast search using
the ‘hrp box’ motif, which is present in the promoters of all
known P. syringae avr genes, has revealed about 70
putative open reading frames (J. Zwiesler-Vollick, A.
Plovanich-Jones, and S. Y. He, unpublished). Some of
these genes could encode bona fide type III effectors and
are therefore candidates for further verification by
experimentation. The DC3000 genome also contains
genes involved in cell wall degradation, extracellular
polysaccharides, and production of phytohormones (e.g.,
IAA), which have been shown to be important in the
virulence of other bacterial pathogens (Alfano and Collmer,
1996). These potential virulence factors (in addition to the
type III secretion system and coronatine toxin) could
therefore contribute to DC3000 aggressiveness in
Arabidopsis tissues.
In summary, we are entering an exciting phase of
research on the Arabidopsis-P. syringae interaction using a
variety of functional genomics tools. We anticipate that
many more structural, computational, and functional
genomics studies of both Arabidopsis and P. syringae will
be completed in the near future, which will provide a
comprehensive picture of interconnecting host and
pathogen pathways that define incompatible and
compatible interactions. We also anticipate the
construction of a comprehensive plant-P. syringae
functional genomics interaction database soon, so expect
a much expanded version of this section in the next
edition!
The Arabidopsis Book 20 of 35
6. CONCLUDING REMARKS
Since the discovery of P. syringae as a pathogen of
Arabidopsis in the late 1980s, tremendous progress has
been made in our understanding of pathogen virulence
and avirulence determinants, the mechanism of host
recognition of pathogen avirulence factors, resistance
signal transduction pathways, and some aspects of host
susceptibility. This progress is made possible because of
the vision of a few pioneering scientists in the late 1980s.
The genetic tractability of both Arabidopsis and P. syringae
has played a critical role in the success of developing the
Arabidopsis-P. syringae pathosystem into a remarkable
model for research on plant-pathogen interactions.
Despite the exciting progress, a number of fundamental
questions remain to be answered. For incompatible
Arabidopsis-P. syringae interactions, we still have no idea
of the actual mechanisms/compounds that stop P.
syringae infection in the apoplast of a resistant plant.
Although the gene-for-gene interactions have been
molecularly defined and provide a clear explanation for
host resistance to avirulent strains of a compatible P.
syringae pathovar (i.e., a pathovar in which some strains
can cause disease in Arabidopsis), we do not know the
molecular basis of the more prevalent nonhost resistance
of Arabidopsis that is extremely effective against the vast
majority of pathogens that are capable of causing disease
in some other plants, but never Arabidopsis. For example,
why don’t any of the P. syringae pv. phaseolicola strains,
which infect bean, infect Arabidopsis? Is this because
Arabidopsis contains all the resistance genes that could
recognize all P. syringae pv. phaseolicola strains? Or is this
because the virulence factors of P. syringae pv.
phaseolicola that are adapted to the bean ‘susceptibility’
targets are not optimized for Arabidopsis? Recently, an
Arabidopsis mutant, nho1 (for nonhost resistance 1), has
been isolated that allows P. syringae pv. phaseolicola, P.
syringae pv. tomato DC3000 hrp mutants, and the
saprophyte P. fluorescens to grow significantly (Lu et al.,
2001). In addition, the nho1 mutation also compromised
resistance mediated by RPS2, RPS4, RPS5, and RPM1,
providing evidence that nonhost resistance is controlled,
at least in part, by general resistance that functions in
gene-for-gene resistance. Further characterization of this
mutant will shed light on the molecular basis of
Arabidopsis nonhost resistance against P. syringae. For
compatible Arabidopsis-P. syringae interactions, the main
challenge is to identify the susceptibility targets of P.
syringae virulence factors and to learn how P. syringae has
evolved to circumvent Arabidopsis defense and at the
same time to cause Arabidopsis cells to release water and
nutrients into the apoplast.
It is important to point out that we are at the beginning
of an era when we can apply powerful scientific
approaches toward understanding biological systems at a
global level, in addition to understanding narrowly
reduced, specific parts of the systems. This capability will
drastically change the way biological research can be
done, the way we think about biology, and the level of
understanding we have in biology. Starting with a model
biological system that is powerful in both genetics and
genomics makes sense for collective efforts toward global
levels of understanding. For the study of plant-pathogen
interactions, the Arabidopsis-P. syringae system is such an
ideal model system. We anticipate a new wave of system-
based discoveries, which will reveal the dynamic,
interconnecting, and flexible nature of the Arabidopsis and
P. syringae signaling networks during interaction. In the
end, we hope that study of this model interaction will
contribute to our appreciation of how plants and bacterial
pathogens have evolved to survive each others’ attacks
and counterattacks, which will in turn help us to develop
sustained control measures by guided interception of
bacterial virulence and/or by selective activation of plant
defense.
ACKNOWLEDGMENTS
We would like to thank Jane Glazebrook and members of
our laboratories for critical reading of the manuscript, and
Karen Bird for editing. Work in Sheng Yang He’s laborato-
ry is supported by funds from the U. S. Department of
Energy, National Science Foundation, and Department of
Agriculture.
REFERENCES
Aarts, N., Metz, M., Holub, E., Staskawicz, B. J., and Daniels,
M.J. (1998) Different requirements for EDS1 and NDR1 by
disease resistance genes define at least two R gene-mediated
signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. USA
95, 10306-10311.
Agrios, G.N. (1997) Plant Pathology. (San Diego: Academic
Press).
Alfano, J.R., and Collmer, A. (1996) Bacterial pathogens in plants:
Life up against the wall. Plant Cell 8, 1683-1698.
Alfano, J.R., and Collmer, A. (1997) The type III (Hrp) secretion
pathway of plant pathogenic bacteria: Trafficking harpins, Avr
proteins, and death. J. Bacteriol. 179, 5655-5662.
Alfano, J.R., Kim, H.-S., Delaney, T.P., and Collmer, A. (1997)
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 21 of 35
Evidence that the Pseudomonas syringae pv. syringae hrp-
linked hrmA gene encodes an Avr-like protein that acts in an
hrp-dependent manner within tobacco cells. Mol. Plant-
Microbe Interact. 10, 580-588.
Arabidopsis Genome Initiative, The (2000) Analysis of the
genome sequence of the flowering plant Arabidopsis thaliana.
Nature 408, 796-813.
Bendahmane, A., Kanyuka, K., and Baulcombe, D.C. (1999) The
Rx gene from potato controls separate virus resistance and cell
death responses. Plant Cell 11, 781-792.
Bender, C.L., Stone, H.E., Sims, J.J., and Cooksey, D.A. (1987)
Reduced pathogen fitness of Pseudomonas syringae pv. tomato
Tn5 mutants defective in coronatine production. Physiol. Mol.
Plant Pathol. 30, 273-283.
Bender, C.L., Alarcon-Chaidez, F., and Gross, D.C. (1999)
Pseudomonas syringae phytotoxins: mode of action, regulation,
and biosynthesis by peptide and polyketide synthetases.
Microbiol. Mol. Biol. Rev. 63, 266-292.
Bent, A.F., Innes, R.W., Ecker, J.R., and Staskawicz, B.J. (1992)
Disease development in ethylene-insensitive Arabidopsis
thaliana infected with virulent and avirulent Pseudomonas and
Xanthomonas pathogens. Mol. Plant-Microbe Interact. 5, 372-
378.
Bent, A.F., Kunkel, B.N., Dahlbeck, D., Brown, K.L., Schmidt,
R., Giraudat, J., Leung, J., and Staskawicz, B.J. (1994) RPS2
of Arabidopsis thaliana: A leucine-rich repeat class of plant
disease resistance genes. Science 265, 1856-1860.
Bent, A.F. (1996) Plant disease resistance genes: Function meets
structure. Plant Cell 8, 1757-1771.
Bent, A.F. (2001) Plant mitogen-activated protein kinase
cascades: Negative regulatory roles turn out positive. Proc.
Natl. Acad. Sci. USA 98, 784-786.
Bergey, D.R., Howe, G.A., and Ryan, C.A. (1996) Polypeptide
signaling for plant defensive genes exhibits analogies to
defense signaling in animals. Proc. Natl. Acad. Sci. USA 93,
12053-12058.
Bestwick, C.S., Bennett, M.H., and Mansfield, J.W. (1995) Hrp
mutant of Pseudomonas syringae pv phaseolicola induces cell
wall alterations but not membrane damage leading to the
hypersensitive reaction in lettuce. Plant Physiol. 108, 503-516.
Bisgrove, S.R., Simonich, M.T., Smith, N.M., Sattler, A., and
Innes, R.W. (1994) A disease resistance gene in Arabidopsis
with specificity for two different pathogen avirulence genes.
Plant Cell 6, 927-933.
Bittner-Eddy, P.D., and Beynon, J.L. (2001) The Arabidopsis
downy mildew resistance gene, RPP13-Nd, functions
independently of NDR1 and EDS1 and does not require the
accumulation of salicylic acid. Mol. Plant-Microbe Interact. 14,
416-421.
Bonas, U., Stall, R.E., and Staskawicz, B. (1989) Genetic and
structural characterization of the avirulence gene avrBs3 from
Xanthomonas campestris pv. vesicatoria. Mol. Gen. Genet. 218,
127-136.
Boyes, D.C., Nam, J., and Dangl, J.L. (1998) The Arabidopsis
thaliana RPM1 disease resistance gene product is a peripheral
plasma membrane protein that is degraded coincident with the
hypersensitive response. Proc. Natl. Acad. Sci. USA 95, 15849-
15854.
Brown, I., Mansfield, J., and Bonas, U. (1995) hrp genes in
Xanthomonas campestris pv. vesicatoria determine ability to
suppress papilla deposition in pepper mesophyll cells. Mol.
Plant-Microbe Interact. 8, 825-836.
Bryan, G.T., Wu, K.S., Farrall, L., Jia, Y., Hershey, H.P.,
McAdams, S.A., Faulk, K.N., Donaldson, G.K., Tarchini, R.,
and Valent, B. (2000) A single amino acid difference
distinguishes resistant and susceptible alleles of the rice blast
resistance gene Pi-ta. Plant Cell 12, 2033-2046.
Cao, H., Bowling, S.A., Gordon, S., and Dong, X. (1994)
Characterization of an Arabidopsis mutant that is
nonresponsive to inducers of systemic acquired resistance.
Plant Cell 6, 1583-1592.
Century, K.S., Holub, E.B., and Staskawicz, B.J. (1995) NDR1, a
locus of Arabidopsis thaliana that is required for disease
resistance to both a bacterial and a fungal pathogen. Proc. Natl.
Acad. Sci. USA 92, 6597-6601.
Chen, Z., Kloek, A.P., Boch, J., Katagiri, F., and Kunkel, B.N.
(2000) The Pseudomonas syringae avrRpt2 gene product
promotes pathogen virulence from inside plant cells. Mol. Plant-
Microbe Interact. 13, 1312-1321.
Collmer, A., Badel, J.L., Charkowski, A.O., Deng, W.L., Fouts,
D.E., Ramos, A.R., Rehm, A.H., Anderson, D.M.,
Schneewind, O., van Dijk, K., and Alfano, J.R. (2000)
Pseudomonas syringae Hrp type III secretion system and
effector proteins. Proc. Natl. Acad. Sci. U S A 97, 8770-8777.
Cornelis, G.R., and Van Gijsegem, F. (2000) Assembly and
function of type III secretory systems. Annu. Rev. Microbiol. 54,
735-774.
Crute, I., Beynon, J., Dangl, J., Huolub, E., Mauch-Mani, B.,
Slusarenko, A., Staskawicz, B.J., and Ausubel, F. (1994)
Microbial pathogenesis of Arabidopsis. In Arabidopsis E.M.
Meyerowitz and C.R. Somerville (eds). (Cold Spring Harbor:
Cold Spring Harbor Laboratory Press), pp. 705-747.
Dangl, J.L., Ritter, C., Gibbon, M.J., Mur, L.A.J., Wood, J.R.,
Goss, S., Mansfield, J., Taylor, J.D., and Vivian, A. (1992)
Functional homologs of the Arabidopsis RPM1 disease
resistance gene in bean and pea. Plant Cell 4, 1359-1369.
Dangl, J.L., Dietrich, R.A., and Richberg, M.H. (1996) Death
don’t have no mercy: cell death programs in plant-microbe
interactions. Plant Cell 8, 1793-1807.
Dangl, J.L., and Jones, J.D.G. (2001) Plant pathogens and
integrated defense responses to infection. Nature 411, 826-833.
Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann,
K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H.,
Ward, E., and Ryals, J. (1994) A central role of salicylic acid in
plant disease resistance. Science 266, 1247-1250.
Delaney, T.P., Friedrich, L., and Ryals, J.A. (1995) Arabidopsis
signal transduction mutant defective in chemically and
biologically induced disease resistance. Proc. Natl. Acad. Sci.
USA 92, 6602-6606.
Dong, X. (1998) SA, JA, ethylene, and disease resistance in plants.
Curr. Opin. Plant Biol. 1, 316-323.
Dong, X., Mindrinos, M., Davis, K.R., and Ausubel, F.M. (1991)
Induction of Arabidopsis defense genes by virulent and avirulent
Pseudomonas syringae strains and by a cloned avirulence gene.
Plant Cell 3, 61-72.
Ellis, J., Dodds, P., and Pryor, T. (2000) Structure, function and
evolution of plant disease resistance genes. Curr. Opin. Plant
Biol. 3, 278-284.
The Arabidopsis Book 22 of 35
Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999) Plants have
a sensitive perception system for the most conserved domain of
bacterial flagellin. Plant J. 18, 265-276.
Felton, G.W., Bi, J.L., Mathews, M.C., Murphy, J.B., Korth, K.,
Wesley, S.V., Lamb, C., and Dixon, R.A. (1999a) Cross-talk
between the signal pathways for pathogen-induced systemic
acquired resistance and grazing-induced insect resistance.
Novartis Found. Symp. 223, 166-171.
Felton, G.W., Korth, K.L., Bi, J.L., Wesley, S.V., Huhman, D.V.,
Mathews, M.C., Murphy, J.B., Lamb, C., and Dixon, R.A.
(1999b) Inverse relationship between systemic resistance of
plants to microorganisms and to insect herbivory. Curr. Biol. 9,
317-320.
Feng, Y., Wente, S.R., and Majerus, P.W. (2001) Overexpression
of the inositol phosphatase SopB in human 293 cells stimulates
cellular chloride influx and inhibits nuclear mRNA export. Proc.
Natl. Acad. Sci. USA 98, 875-879.
Ferguson, I.B., and Mitchell, R.E. (1985) Stimulation of ethylene
production in bean leaf discs by the pseudomonad phytotoxin
coronatine. Plant Physiol. 77, 969-973.
Feys, B.J.F., Benedetti, C.E., Penfold, C.N., and Turner, J.G.
(1994) Arabidopsis mutants selected for resistance to the
phytotoxin coronatine are male sterile, insensitive to methyl
jasmonate, and resistant to a bacterial pathogen. Plant Cell 6,
751-759.
Flor, H.H. (1971) Current status of gene-for-gene concept. Ann.
Rev. Phytopathol. 9, 275-296.
Frederick, R.D., Thilmony, R.L., Sessa, G., and Martin, G.B.
(1998) Recognition specificity for the bacterial avirulence
protein AvrPto is determined by Thr-204 in the activation loop of
the tomato Pto kinase. Mol. Cell 2, 241-245.
Gabriel, D.W., and Rolfe, B.G. (1990) Working models of specific
recognition in plant-microbe interactions. Ann. Rev.
Phytopathol. 28, 365-391.
Galan, J.E., and Collmer, A. (1999) Type III secretion machines:
Bacterial devices for protein delivery into host cells. Science
284, 1322-1328.
Galan, J.E., and Zhou, D. (2000) Striking a balance: modulation of
the actin cytoskeleton by Salmonella. Proc. Natl. Acad. Sci.
USA 97, 8754-8761.
Gardan, L., Shafik, H., Belouin, S., Broch, R., Grimont, F., and
Grimont, P.A. (1999) DNA relatedness among the pathovars of
Pseudomonas syringae and description of Pseudomonas
tremae sp. nov. and Pseudomonas cannabina sp. nov. (ex Sutic
and Dowson 1959). Int. J. Syst. Bacteriol. 49, 469-478.
Gassmann, W., Hinsch, M.E., and Staskawicz, B.J. (1999) The
Arabidopsis RPS4 bacterial-resistance gene is a member of the
TIR-NBS-LRR family of disease-resistance genes. Plant J. 20,
265-277.
Glazebrook, J. (2001) Genes controlling expression of defense
responses in Arabidopsis – 2001 status. Curr. Opin. Plant Biol.
4, 301-308.
Glazebrook, J., and Ausubel, F.M. (1994) Isolation of phytoalexin-
deficient mutants of Arabidopsis thaliana and characterization
of their interactions with bacterial pathogens. Proc. Natl. Acad.
Sci. USA 91, 8955-8959.
Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996) Isolation
of Arabidopsis mutants with enhanced disease susceptibility by
direct screening. Genetics 143, 973-982.
Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1997a) Use of
Arabidopsis for genetic dissection of plant defense responses.
Annu. Rev. Genet. 31, 547-569.
Glazebrook, J., Zook, M., Mert, F., Kagan, I., Rogers, E.E.,
Crute, I.R., Holub, E.B., Hammerschmidt, R., and Ausubel,
F.M. (1997b) Phytoalexin-deficient mutants of Arabidopsis
reveal that PAD4 encodes a regulatory factor and that four PAD
genes contribute to downy mildew resistance. Genetics 146,
381-192.
Gnanamaickam, S.S., Starratt, A.N., and Ward, E.W.B. (1982)
Coronatine production in vitro and in vivo and its relation to
symptom development in bacterial blight of soybean. Can. J.
Microbiol. 60, 645-650.
Gomez-Gomez, L., and Boller, T. (2000) FLS2: an LRR receptor-
like kinase involved in the perception of the bacterial elicitor
flagellin in Arabidopsis. Mol. Cell 5, 1003-1011.
Gopalan, S., Bauer, D.W., Alfano, J.R., Loniello, A.O., He, S.Y.,
and Collmer, A. (1996) Expression of the Pseudomonas
syringae avirulence protein AvrB in plant cells alleviates its
dependence on the hypersensitive response and pathogenicity
(Hrp) secretion system in eliciting genotype-specific
hypersensitive cell death. Plant Cell 8, 1095-1105.
Grant, M.R., Godiard, L., Straube, E., Ashfield, T., Lewald, J.,
Sattler, A., Innes, R.W., and Dangl, J.L. (1995) Structure of the
Arabidopsis RPM1 gene which enables dual-specificity disease
resistance. Science 269, 843-846.
Greenberg, J.T. (1996) Programmed cell death: A way of life for
plants. Proc. Natl. Acad. Sci., USA 93, 12094-12097.
Greulich, F., Yoshihara, T., and Ichihara, A. (1995) Coronatine, a
bacterial phytotoxin, acts as a stereospecific analog of
jasmonate type signals in tomato cells and potato tissues. J.
Plant Physiol. 147, 359-366.
Guttman, D.S., and Greenberg, J.T. (2001) Functional analysis of
the type III effectors AvrRpt2 and AvrRpm1 of Pseudomonas
syringae with the use of a single-copy genomic integration
system. Mol. Plant-Microbe Interact. 14, 145-155.
Hammerschmidt, R., and Dann, E. K. (1999) The role of
phytoalexins in plant protection. Novartis Found. Symp. 223,
175-187.
Hammond-Kosack, K.E., and Jones, J.D.G. (1997) Plant disease
resistance genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,
575-607.
Hancock, J.G., and Huisman, O.C. 1981. Nutrient movement in
host-pathogen systems. Annu. Rev. Phytopathol. 19, 309-331.
He, S.Y. (1998) Type III secretion systems in animal and plant
pathogenic bacteria. Annu. Rev. Phytopathol. 36, 363-392.
Hinsch, M., and Staskawicz, B. (1996) Identification of a new
Arabidopsis disease resistance locus, RPS4, and cloning of the
corresponding avirulence gene, avrRps4, from Pseudomonas
syringae pv. pisi. Mol. Plant-Microbe Interact. 9, 55-61.
Hirano, S.S., and Upper, C.D. (2000) Bacteria in the leaf
ecosystem with emphasis on Pseudomonas syringae-a
pathogen, ice nucleus, and epiphyte. Microbiol. Mol. Biol. Rev.
64, 624-653.
Hu, W., Yuan, J., Jin, Q.L., Hart, P., and He, S.Y. (2001)
Immunogold labeling of Hrp pili of Pseudomonas syringae pv.
tomato assembled in minimal medium and in planta. Mol. Plant-
Microbe Interact. 14, 234-241.
Hueck, C.J. (1998) Type III protein secretion systems in bacterial
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 23 of 35
pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62,
379-433.
Innes, R.W. (1998) Genetic dissection of R gene signal
transduction pathways. Curr. Opin. Plant Biol. 1, 299-304.
Innes, R., Bent, A., Kunkel, B., Bisgrove, S., and Staskawicz, B.
(1993) Molecular analysis of avirulence gene avrRpt2 and
identification of a putative regulatory sequence common to all
known Pseudomonas syringae avirulence genes. J. Bacteriol.
175, 4859-4869.
Jackson, R.W., Athanassopoulos, E., Tsiamis, G., Mansfield,
J.W., Sesma, A., Arnold, D.L., Gibbon, M.J., Murillo, J.,
Taylor, J.D., and Vivian, A. (1999) Identification of a
pathogenicity island, which contains genes for virulence and
avirulence, on a large native plasmid in the bean pathogen
Pseudomonas syringae pathovar phaseolicola. Proc. Natl.
Acad. Sci. USA 96, 10875-10880.
Jakobek, J.L., Smith, J.A., and Lindgren, P.B. (1993)
Suppression of bean defense responses by Pseudomonas
syringae. Plant Cell 5, 57-63.
Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent,
B. (2000) Direct interaction of resistance gene and avirulence
gene products confers rice blast resistance. EMBO J. 19, 4004-
4014.
Jin, Q., Hu, W., Brown, I., McGhee, G., Hart, P., Jones, A.L., and
He, S.Y. (2001) Visualization of secreted Hrp and Avr proteins
along the Hrp pilus during type III secretion in Erwinia amylovora
and Pseudomonas syringae. Mol. Microbiol. 40, 1129-1139.
Kachroo, P., Yoshioka, K., Shah, J., Dooner, H.K., and Klessig,
D.F. (2000) Resistance to turnip crinkle virus in Arabidopsis is
regulated by two host genes and is salicylic acid dependent but
NPR1, ethylene, and jasmonate independent. Plant Cell 12,
677-690.
Keen, N.T. (1990) Gene-for-gene complementarity in plant-
pathogen interactions. Annu. Rev. Genet. 24, 447-463.
Keen, N.T., Tamaki, S., Kobayashi, D., Gerhold, D., Stayton, M.,
Shen, H., Gold, S., Lorang, J., Thordal-Christensen, H.,
Dahlbeck, D., and Staskawicz, B. (1990) Bacteria expressing
avirulence gene D produce a specific elicitor of the soybean
hypersensitive reaction. Mol. Plant-Microbe Interact. 3, 112-121.
Kenyon, J.S., and Turner, J.G. (1992) The stimulation of ethylene
synthesis in Nicotiana tabacum leaves by the phytotoxin
coronatine. Plant Physiol. 100, 219-224.
Kinkema, M., Fan, W., and Dong, X. (2000) Nuclear localization of
NPR1 is required for activation of PR gene expression. Plant
Cell 12, 2339-2350.
Kjemtrup, S., Nimchuk, Z., and Dangl, J.L. (2000) Effector
proteins of phytopathogenic bacteria: bifunctional signals in
virulence and host recognition. Curr. Opin. Microbiol. 3, 73-78.
Klement, Z. (1963) Rapid detection of pathogenicity of
phytopathogenic pseudomonads. Nature 199, 299- 300.
Klement, Z., Farkas, G.L., and Lovrekovich, L. (1964)
Hypersensitive reaction induced by phytopathogenic bacteria in
the tobacco leaf. Phytopathology 54, 474-477.
Kloek, A.P., Verbsky, M.L., Sharma, A.B., Schoelz, J.E., Vogel,
J., Klessig, D.F., and Kunkel, B.N. (2001) Resistance to
Pseudomonas syringae conferred by an Arabidopsis thaliana
coronatine-insensitive (coi1) mutation occurs through two
distinct mechanisms. Plant J. In press.
Knoester, M., Pieterse, C.M., Bol, J.F., and van Loon, L.C.
(1999) Systemic resistance in Arabidopsis induced by
rhizobacteria requires ethylene-dependent signaling at the site
of application. Mol. Plant-Microbe Interact. 12, 720-727.
Koda, Y., Takahashi, K., Kikuta, Y., Greulich, F., Toshima, H.,
and Ichihara, A. (1996) Similarities of the biological activities of
coronatine and coronafacic acid to those of jasmonic acid.
Phytochemistry 41, 93-96.
Kunkel, B.N., Bent, A.F., Dahlbeck, D., Innes, R.W., and
Staskawicz, B.J. (1993) RPS2, an Arabidopsis disease
resistance locus specifying recognition of Pseudomonas
syringae strains expressing the avirulence gene avrRpt2. Plant
Cell 5, 865-875.
Latres, E., Chiaur, D.S., and Pagano, M. (1999) The human F box
protein beta-Trcp associates with the Cul1/Skp1 complex and
regulates the stability of beta-catenin. Oncogene 18, 849-854.
Leister, R.T., Ausubel, F.M., and Katagiri, F. (1996) Molecular
recognition of pathogen attack occurs inside of plant cells in
plant disease resistance specified by the Arabidopsis genes
RPS2 and RPM1. Proc. Natl. Acad. Sci. USA 93, 15497-15502.
Leister, R.T., and Katagiri, F. (2000) A resistance gene product of
the nucleotide binding site – leucine rich repeats class can form
a complex with bacterial avirulence proteins in vivo. Plant J. 22,
345-354.
Lindgren, P.B. (1997) The role of hrp genes during plant-bacterial
interactions. Annu. Rev. Phytopathol. 35, 129-152.
Lu, M., Tang, X., and Zhou, J.M. (2001) Arabidopsis NHO1 is
required for general resistance against Pseudomonas bacteria.
Plant Cell 13, 437-447.
Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J.,
Lawton, K.A., Dangl, J.L., and Dietrich, R.A. (2000) The
transcriptome of Arabidopsis thaliana during systemic acquired
resistance. Nat. Genet. 26, 403-410.
Marti, A., Wirbelauer, C., Scheffner, M., and Krek, W. (1999)
Interaction between ubiquitin-protein ligase SCFSKP2 and E2F-
1 underlies the regulation of E2F-1 degradation. Nat. Cell Biol.
1, 14-19.
Martin, G.B., Brommonschenkel, S.H., Chunwongse, J., Frary,
A., Ganal, M.W., Spivey, R., Wu, T., Earle, E.D., and Tanksley,
S.D. (1993) Map-based cloning of a protein kinase gene
conferring disease resistance in tomato. Science 262, 1432-
1436.
McDowell, J.M., Dhandaydham, M., Long, T.A., Aarts, M.G.,
Goff, S., Holub, E.B., and Dangl, J.L. (1998) Intragenic
recombination and diversifying selection contribute to the
evolution of downy mildew resistance at the RPP8 locus of
Arabidopsis. Plant Cell 10, 1861-1874.
McNellis, T.W., Mudgett, M.B., Li, K., Aoyama, T., Horvath, D.,
Chua, N.H., and Staskawicz, B.J. (1998) Glucocorticoid-
inducible expression of a bacterial avirulence gene in transgenic
Arabidopsis induces hypersensitive cell death. Plant J. 14, 247-
257.
Mindrinos, M., Katagiri, F., Yu, G.-L., and Ausubel, F.M. (1994)
The Arabidopsis thaliana disease resistance gene RPS2
encodes a protein containing a nucleotide-binding site and
leucine-rich repeats. Cell 78, 1089-1099.
Mittal, S., and Davis, K.R. (1995) Role of the phytotoxin
coronatine in the infection of Arabidopsis thaliana by
Pseudomonas syringae pv. tomato. Mol. Plant Microbe-Interact.
8, 165-171.
The Arabidopsis Book 24 of 35
Mudgett, M.B., and Staskawicz, B.J. (1998) Protein signaling via
type III secretion pathways in phytopathogenic bacteria. Curr.
Opin. Microbiol. 1, 109-114.
Mudgett, M.B., and Staskawicz, B.J. (1999) Characterization of
the Pseudomonas syringae pv. tomato AvrRpt2 protein:
demonstration of secretion and processing during bacterial
pathogenesis. Mol. Microbiol. 32, 927-941.
Mudgett, M.B., Chesnokova, O., Dahlbeck, D., Clark, E.T.,
Rossier, O., Bonas, U., and Staskawicz, B.J. (2000) Molecular
signals required for type III secretion and translocation of the
Xanthomonas campestris AvrBs2 protein to pepper plants.
Proc. Natl. Acad. Sci. USA 97, 13324-13329.
Nimchuk, Z., Marois, E., Kjemtrup, S., Leister, R.T., Katagiri, F.,
and Dangl, J.L. (2000) Eukaryotic fatty acylation drives plasma
membrane targeting and enhances function of several type III
effector proteins from Pseudomonas syringae. Cell 101, 353-
363.
Orth, K., Palmer, L.E., Bao, Z.Q., Stewart, S., Rudolph, A.E.,
Bliska, J.B., and Dixon, J.E. (1999) Inhibition of the mitogen-
activated protein kinase kinase superfamily by a Yersinia
effector. Science 285, 1920-1923.
Orth, K., Xu, Z., Mudgett, M.B., Bao, Z.Q., Palmer, L.E., Bliska,
J.B., Mangel, W.F., Staskawicz, B., and Dixon, J.E. (2000)
Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like
protein protease. Science 290, 1594-1597.
Pieterse, C.M., and van Loon, L.C. (1999) Salicylic acid-
independent plant defense pathways. Trends Plant Sci. 4, 52-
58.
Pieterse, C.M., van Wees, S.C., Hoffland, E., van Pelt, J.A., and
van Loon, L.C. (1996) Systemic resistance in Arabidopsis
induced by biocontrol bacteria is independent of salicylic acid
accumulation and pathogenesis-related gene expression. Plant
Cell 8, 1225-1237.
Pieterse, C.M., van Wees, S.C., van Pelt, J.A., Knoester, M.,
Laan, R., Gerrits, H., Weisbeek, P.J., and van Loon, L.C.
(1998) A novel signaling pathway controlling induced systemic
resistance in Arabidopsis. Plant Cell 10, 1571-1580.
Pirhonen, M.U., Lidell, M.C., Rowley, D.L., Lee, S.W., Jin, S.,
Liang, Y., Silverstone, S., Keen, N.T., and Hutcheson, S.W.
(1996) Phenotypic expression of Pseudomonas syringae avr
genes in E. coli linked to the activities of the hrp-encoded
secretion system. Mol. Plant-Microbe Interact. 9, 252-260.
Preston, G. (2000) Pseudomonas syringae pv. tomato: the right
pathogen, of the right plant, at the right time. Mol. Plant Pathol.
1, 263-275.
Reuber, T.L., and Ausubel, F.M. (1996) Isolation of Arabidopsis
genes that differentiate between resistance responses
mediated by the RPS2 and RPM1 disease resistance genes.
Plant Cell 8, 241-249.
Ritter, C., and Dangl, J.L. (1995) The avrRpm1 gene of
Pseudomonas syringae pv. maculicola is required for virulence
on Arabidopsis. Mol. Plant-Microbe Interact. 8, 444-453.
Ritter, C., and Dangl, J.L. (1996) Interference between two
specific pathogen recognition events mediated by distinct plant
disease resistance genes. Plant Cell 8, 251-257.
Rogers, E.E., Glazebrook, J., and Ausubel, F.M. (1996) Mode of
action of the Arabidopsis thaliana phytoalexin camalexin and its
role in Arabidopsis-pathogen interactions. Mol. Plant-Microbe
Interact. 9, 748-757.
Roine, E., Wei, W., Yuan, J., Nurmiaho-Lassila, E.-L., Kalkkinen,
N., Romantschuk, M., and He, S.Y. (1997) Hrp pilus: An hrp-
dependent bacterial surface appendage produced by
Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad.
Sci. USA 94, 3459-3464.
Rossi, M., Goggin, F.L., Milligan, S.B., Kaloshian, I., Ullman,
D.E., and Williamson, V.M. (1998) The nematode resistance
gene Mi of tomato confers resistance against the potato aphid.
Proc. Natl. Acad. Sci. USA 95, 9750-9754.
Ryals, J.A., Newenschwander, U.H., Willits, M.G., Molina, A.,
Steiner, H.-Y., and Hunt, M.D. (1996) Systemic acquired
resistance. Plant Cell 8, 1809-1819.
Ryan, C.A., and Pearce, G. (1998) Systemin: a polypeptide signal
for plant defensive genes. Annu. Rev. Cell. Dev. Biol. 14, 1-17.
Salmeron, J.M., Oldroyd, G.E.D., Rommens, C.M.T., Scofield,
S.R., Kim, H.-S., Lavelle, D.T., Dahlbeck, D., and Staskawicz,
B.J. (1996) Tomato Prf is a member of the leucine-rich repeat
class of plant disease resistance genes and lies embedded
within the Pto kinase gene cluster. Cell 86, 123-133.
Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle,
D.T., Michelmore, R.W., and Staskawicz, B.J. (1996)
Molecular basis of gene-for-gene specificity in bacterial speck
disease of tomato. Science 274, 2063-2065.
Shen, H., and Keen, N.T. (1993) Characterization of the promoter
of avirulence gene D from Pseudomonas syringae pv. tomato. J.
Bacteriol. 175, 5916-5924.
Shirasu, K., Nakajima, H., Rajasekhar, V.K., Dixon, R.A., and
Lamb, C. (1997) Salicylic acid potentiates an agonist-
dependent gain control that amplifies pathogen signals in the
activation of defense mechanisms. Plant Cell 9, 261-270.
Simonich, M.T., and Innes, R.W. (1995) A disease resistance gene
in Arabidopsis with specificity for the avrPph3 gene of
Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe
Interact. 8, 637-340.
Spencer, E., Jiang, J., and Chen, Z.J. (1999) Signal-induced
ubiquitination of IkappaBalpha by the F-box protein Slimb/beta-
TrCP. Genes Dev. 13, 284-294.
Spiegelman, V.S., Stavropoulos, P., Latres, E., Pagano, M.,
Ronai, Z., Slaga, T.J., and Fuchs, S.Y. (2001) Induction of
beta-TrCP by JNK signaling and its role in the activation of NF-
kappaB. J. Biol. Chem. 24, 24.
Stahl, E.A., Dwyer, G., Mauricio, R., Kreitman, M., and
Bergelson, J. (1999) Dynamics of disease resistance
polymorphism at the Rpm1 locus of Arabidopsis. Nature 400,
667-671.
Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E.
(2001) Comon and contrasting themes of plant and animal
diseses. Science 292, 2285-2289.
Stevens, C., Bennett, M.A., Athanassopoulos, E., Tsiamis, G.,
Taylor, J.D., and Mansfield, J.W. (1998) Sequence variations in
alleles of the avirulence gene avrPphE.R2 from Pseudomonas
syringae pv. phaseolicola lead to loss of recognition of the
AvrPphE protein within bean cells and a gain in cultivar-specific
virulence. Mol. Microbiol. 29, 165-177.
Swiderski, M.R., and Innes, R.W. (2001) The Arabidopsis PBS1
resistance gene encodes a member of a novel protein kinase
subfamily. Plant J. 26, 101-112.
Swords, K.M., Dahlbeck, D., Kearney, B., Roy, M., and
Staskawicz, B.J. (1996) Spontaneous and induced mutations
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 25 of 35
in a single open reading frame alter both virulence and
avirulence in Xanthomonas campestris pv. vesicatoria avrBs2. J.
Bacteriol. 178, 4661-4669.
Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y., and
Martin, G.B. (1996) Initiation of plant disease resistance by
physical interaction of AvrPto and Pto kinase. Science 274,
2060-2062.
Tao, Y., Yuan, F., Leister, R.T., Ausubel, F.M., and Katagiri, F.
(2000) Mutational analysis of the Arabidopsis nucleotide binding
site-leucine-rich repeat resistance gene RPS2. Plant Cell 12,
2541-2554.
Thomma, B.P., Eggermont, K., Penninckx, I., Mauch-Mani, B.,
Vogelsang, R., Cammue, B.P.A., and Broekaert, W.F. (1998)
Separate jasmonate-dependent and salicylate-dependent
defense-response pathways in Arabidopsis are essential for
resistance to distinct microbial pathogens. Proc. Natl. Acad.
Sci. U S A 95, 15107-15111.
Thomma, B.P., Nelissen, I., Eggermont, K., and Broekaert, W.F.
(1999) Deficiency in phytoalexin production causes enhanced
susceptibility of Arabidopsis thaliana to the fungus Alternaria
brassicicola. Plant J. 19, 163-171.
Thomma, B.P., Penninckx, I.A., Broekaert, W.F., and Cammue,
B.P. (2001) The complexity of disease signaling in Arabidopsis.
Curr. Opin. Immunol. 13, 63-68.
Ton, J., Davison, S., van Wees, S.C., van Loon, L., and Pieterse,
C.M. (1999a) The Arabidopsis isr1 locus controlling
rhizobacteria-mediated induced systemic resistance is involved
in ethylene signaling. Plant Physiol. 125, 652-661.
Ton, J., Pieterse, C.M., and van Loon, L.C. (1999b) Identification
of a locus in Arabidopsis controlling both the expression of
rhizobacteria-mediated induced systemic resistance (ISR) and
basal resistance against Pseudomonas syringae pv. tomato.
Mol. Plant-Microbe Interact. 12, 911-918.
Tsiamis, G., Mansfield, J.W., Hockenhull, R., Jackson, R.W.,
Sesma, A., Athanassopoulos, E., Bennett, M.A., Stevens, C.,
Vivian, A., Taylor, J.D., and Murillo, J. (2000) Cultivar-specific
avirulence and virulence functions assigned to avrPphF in
Pseudomonas syringae pv. phaseolicola, the cause of bean
halo-blight disease. EMBO J. 19, 3204-3214.
van der Biezen, E.A., and Jones, J.D. (1998a) Plant disease-
resistance proteins and the gene-for-gene concept. Trends
Biochem. Sci. 23, 454-456.
van der Biezen, E.A., and Jones, J.D.G. (1998b) The NB-ARC
domain: a novel signalling motif shared by plant resistance gene
products and regulators of cell death in animals. Curr. Biol. 8,
R226-R227.
van der Vossen, E.A., van der Voort, J.N., Kanyuka, K.,
Bendahmane, A., Sandbrink, H., Baulcombe, D.C., Bakker,
J., Stiekema, W.J., and Klein-Lankhorst, R.M. (2000)
Homologues of a single resistance-gene cluster in potato confer
resistance to distinct pathogens: a virus and a nematode. Plant
J. 23, 567-576.
van Wees, S.C., Luijendijk, M., Smoorenburg, I., van Loon, L.C.,
and Pieterse, C.M. (1999) Rhizobacteria-mediated induced
systemic resistance (ISR) in Arabidopsis is not associated with
a direct effect on expression of known defense- related genes
but stimulates the expression of the jasmonate-inducible gene
AtVSP upon challenge. Plant Mol. Biol. 41, 537-549.
van Wees, S.C., de Swart, E.A., van Pelt, J.A., van Loon, L.C.,
and Pieterse, C.M. (2000) Enhancement of induced disease
resistance by simultaneous activation of salicylate- and
jasmonate-dependent defense pathways in Arabidopsis
thaliana. Proc. Natl. Acad. Sci. USA 97, 8711-8716.
Vazquez-Torres, A., and Fang, F.C. (2001) Oxygen-dependent
anti-Salmonella activity of macrophages. Trends Microbiol. 9,
29-33.
Vazquez-Torres, A., Fantuzzi, G., Edwards, C.K., 3rd, Dinarello,
C.A., and Fang, F.C. (2001) Defective localization of the NADPH
phagocyte oxidase to Salmonella- containing phagosomes in
tumor necrosis factor p55 receptor-deficient macrophages.
Proc. Natl. Acad. Sci. USA 98, 2561-2565.
Vazquez-Torres, A., Xu, Y., Jones-Carson, J., Holden, D.W.,
Lucia, S.M., Dinauer, M.C., Mastroeni, P., and Fang, F.C.
(2000) Salmonella pathogenicity island 2-dependent evasion of
the phagocyte NADPH oxidase. Science 287, 1655-1658.
Vernooij, E.A. (1994) Salicylic acid is not the translocated signal
responsible for inducing systemic acquired resistance but is
required in signal transduction. Plant Cell 6, 959-965.
Warren, R.F., Henk, A., Mowery, P., Holub, E., and Innes, R.W.
(1998) A mutation in the leucine-rich repeat domain of the
Arabidopsis disease resistance gene RPS5 partially suppresses
multiple bacterial and downy mildew resistance genes. Plant
Cell 10, 1439-1452.
Warren, R.F., Merritt, P.M., Holub, E., and Innes, R.W. (1999)
Identification of three putative signal transduction genes
involved in R gene-specified disease resistance in Arabidopsis.
Genetics 152, 401-412.
Wei, W., Plovanich-Jones, A., Deng, W.L., Jin, Q.L., Collmer, A.,
Huang, H.C., and He, S.Y. (2000) The gene coding for the Hrp
pilus structural protein is required for type III secretion of Hrp
and Avr proteins in Pseudomonas syringae pv. tomato. Proc.
Natl. Acad. Sci. USA 97, 2247-2252.
Weiler, E.W., Kutchan, T.M., Gorba, T., Brodschelm, W., Neisel,
U., and Bublitz, F. (1994) The Pseudomonas phytotoxin
coronatine mimics octadecanoid signaling molecules of higher
plants. FEBS Lett. 345, 9-13.
Whalen, M.C., Innes, R.W., Bent, A.F., and Staskawicz, B.J.
(1991) Identification of Pseudomonas syringae pathogens of
Arabidopsis and a bacterial locus determining avirulence on
both Arabidopsis and soybean. Plant Cell 3, 49-59.
White, F.F., Yang, B., and Johnson, L.B. (2000) Prospects for
understanding avirulence gene function. Curr. Opin. Plant Biol.
3, 291-298.
Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R., Corr, C.,
and Baker, B. (1994) The product of the tobacco mosaic
resistance gene N: Similarity to toll and the interleukin-1
receptor. Cell 78, 1101-1105.
Xiao, Y., Heu, S., Yi, J., Lu, L., and Hutcheson, S. (1994)
Identification of a putative alternate sigma factor and
characterization of a multicomponent regulatory cascade
controlling the expression of Pseudomonas syringae pv.
syringae Pss61 hrp and hrmA genes. J. Bacteriol. 176, 1025-
1036.
Xie, D.X., Feys, B.F., James, S., Nieto-Rostro, M., and Turner,
J.G. (1998) COI1: an Arabidopsis gene required for jasmonate-
regulated defense and fertility. Science 280, 1091-1094.
Yang, B., Zhu, W., Johnson, L.B., and White, F.F. (2000) The
virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a
The Arabidopsis Book 26 of 35
type III secretion pathway-dependent nuclear-localized double-
stranded DNA-binding protein. Proc. Natl. Acad. Sci. USA 97,
9807-9812.
Yang, Y., and Gabriel, D.W. (1995) Xanthomonas
avirulence/pathogenicity gene family encodes functional plant
nuclear targeting signals. Mol. Plant-Microbe Interact. 8, 627-
631.
Yu, G.-L., Katagiri, F., and Ausubel, F.M. (1993) Arabidopsis
mutations at the RPS2 locus result in loss of resistance to
Pseudomonas syringae strains expressing the avirulence gene
avrRpt2. Mol. Plant-Microbe Interact. 6, 434-443.
Zhou, N., Tootle, T.L., and Glazebrook, J. (1999) Arabidopsis
PAD3, a gene required for camalexin biosynthesis, encodes a
putative cytochrome P450 monooxygenase. Plant Cell 11,
2419-2428.
Zhu, T., and Wang, X. (2000) Large-scale profiling of the
Arabidopsis transcriptome. Plant Physiol. 124, 1472-1476.
Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B., and White, F.F.
(1998) AvrXa10 contains an acidic transcriptional activation
domain in the functionally conserved C terminus. Mol. Plant-
Microbe Interact. 11, 824-832.
Zhu, W., Yang, B., Wills, N., Johnson, L.B., and White, F.F. (1999)
The C Terminus of AvrXa10 can be replaced by the
transcriptional activation domain of VP16 from the Herpes
Simplex Virus. Plant Cell 11, 1665-1674.
APPENDIX I: A LIST OF TECHNICAL TERMS TO BE
LINKED TO THE MAIN TEXT
Apoplast: Intercellular space in the plant tissue. For most
bacterial pathogens, this is their native habitat.
Avirulence (avr) genes: Pathogen genes that encode
proteins (usually secreted) that are recognized by plant
disease resistance gene products to trigger plant defense
responses. Some Avr proteins function as enzymes to
produce secondary elicitors. Many avirulence genes play
a role in bacterial virulence in the absence of R-gene-
mediated recognition in susceptible hosts.
Avirulent pathogen: A pathogen in a resistant plant. An
avirulent pathogen still causes disease in susceptible
host plants.
Compatible interaction: An interaction between a
susceptible plant and a virulent pathogen, resulting in
disease.
Coronatine: A polyketide phytotoxin (see Figure 9)
produced by several pathovars of Pseudomonas
syringae; it is required for the full virulence of the
pathogen. The molecular basis by which coronatine
contributes to bacterial virulence is not understood, but
in tomato leaves it promotes disease chlorosis.
Increasing evidence suggests that coronatine mimics, at
least in part, the plant wounding response hormone
jasmonic acid.
Disease chlorosis: A common disease symptom in
pathogen infection in which the leaf tissue appears
yellow due to the loss of chlorophyll. In the case of
Pseudomonas syringae infection of Arabidopsis leaves,
the chlorosis symptom occurs relatively late, usually on
day 3 after pathogen infection. The molecular basis of
tissue chlorosis is not known, but pathogen toxins,
coronatine in the case of Pseudomonas syringae
infection of tomato leaves, may be responsible.
Disease necrosis: A common, slow-developing disease
symptom caused by necrotrophic pathogens. In the
case of Pseudomonas syringae infection of Arabidopsis
leaves, tissue necrosis appears at very late stage of
disease development. The molecular basis of disease
necrosis and its relationship to the much more rapid HR
necrosis during incompatible interactions are not
known.
Epiphytic growth: Many bacterial pathogens, including
Pseudomonas syringae, can survive and multiply on the
plant surface as epiphytes without causing disease.
Ethylene: A gaseous plant growth regulator involved in
plant responses as diverse as fruit ripening, leaf
senescence, and plant tolerance/resistance of microbial
pathogens.
Gene-for-gene theory: H.H. Flor proposed this theory in
the 1940s to explain the results from his study of the
inheritance of rust resistance in flax (Linum
usitatissimum) and pathogenicity in the flax rust fungus
(Melampsora lini). Flor stated that “Host-parasite
interaction in flax rust may be explained by assuming a
gene-for-gene relationship between rust reaction in the
host and pathogenicity in the parasite.” The quadratic
checks (Table 2) are used to illustrate these reactions in
which an incompatible reaction occurs when the host
has a resistance gene and the pathogen contains a
corresponding avirulence gene. We now know that the
gene-for-gene interaction occurs in many other
genetically defined pathosystems, although in some
cases the interactions may be more complicated,
involving multiple host resistance genes and/or multiple
pathogen avirulence genes (see Table 3).
Growth curve: An unfitted curve generated from plotting
log (culturable bacterial number/cm2 leaf tissue) against
time after pathogen inoculation (usually in days). This is
a standard means of evaluating how well a bacterial
pathogen multiplies in plant tissues.
Host resistance: A form of plant resistance by which
some cultivars of a plant species prevent infection by
some strains of a virulent pathogen. In all cases known,
the mechanism involves gene-for-gene interaction.
hrp genes: Genes required for bacteria to elicit the
hypersensitive reaction in resistant plants and to cause
disease in susceptible plants, hence Hypersensitive
Reaction and Pathogenicity genes. Most hrp genes are
involved in the regulation and assembly of a type III
protein secretion apparatus. These genes, usually
clustered in the genome or on a plasmid, are present in
most Gram-negative bacterial plant pathogens. Nine
hrp genes are also conserved in all animal and human
pathogenic bacteria that contain a functional type III
secretion system and are therefore called hrc, for hrp
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 27 of 35
gene conserved.
Hypersensitive response (HR): Rapid, localized plant cell
death upon contact with avirulent pathogens. HR is
considered to be a key component of multifaceted plant
defense responses to restrict attempted infection by
avirulent pathogens.
Incompatible interaction: An interaction between a
resistant plant and an avirulent pathogen, resulting in no
disease.
Induced systemic resistance (ISR): A long-lasting,
broad-spectrum resistance induced throughout
otherwise susceptible plants by prior local inoculation of
certain plant growth-promoting rhizobacteria (PGPR).
Components of jasmonate and ethylene signaling
pathways, but not the SA signaling pathway, are
required for ISR.
Jasmonic acid: Jasmonic acid and methyl jasmonate
(MeJA) are plant growth regulators derived from the
octadecanoid signaling pathway that is elicited by
wounding and insect chewing. JA signaling is required
for pollen development, insect resistance, and
resistance to certain fungal pathogens.
Local resistance: Plant defense mounted locally in the
infected leaves/other tissues in response to infection of
avirulent and virulent pathogens. The local resistance
mechanism involving gene-for-gene recognition usually
triggers SAR throughout the infected plants. PR genes
are activated locally around the infection sites,
suggesting some mechanistic overlap between local
resistance and SAR.
Nonhost resistance: A form of plant resistance by which
most plant species prevent infection of most species of
pathogens. The underlying mechanisms are not
understood, but could involve preformed defense
barriers and chemicals, gene-for-gene resistance,
and/or mismatch of pathogen virulence factors and host
susceptibility targets.
Oxidative burst: Upon pathogen infection, plants rapidly
accumulate reactive oxygen species, such as H2O2 and
O-2, as part of an early defense response. The
magnitude and duration of an oxidative burst are
important in determining its function in plant responses.
In plant-bacteria interactions, for example, a transient
and nonspecific oxidative burst occurs at 30 min after
inoculation with either a virulent or avirulent pathogen.
However, a second and longer-lasting oxidative burst is
activated only by an avirulent pathogen, which is
correlated with host resistance. An oxidative burst
could potentially kill the invading pathogens directly as
well as serve as second messengers for activating other
plant defense responses.
Pathogenicity: A term to describe the qualitative
capability of a pathogen to cause disease.
Pathovar: This is a unique infrasubspecific taxonomical
term used only for plant pathogenic bacteria. The
pathovar is used to distinguish among bacteria within
the species that exhibit different host ranges.
Nutritional, biochemical, physiological, and nucleic acid-
based tests (e.g., DNA hybridization, restriction
fragment length polymorphism, and repetitive DNA
PCR-based genetic fingerprinting) are generally in
agreement with the groupings made on the basis of host
range.
Pathogenesis Related (PR) proteins: These proteins are
induced throughout the infected plant in response to
pathogen infection and are associated with SAR. Some
PR proteins (such as chitinases and b-1,3-glucanases)
exhibit antifungal activity in vitro.
Phytoalexins: Small anti-microbial compounds produced
by plants in response to infection.
Papilla: A structure often observed at the pathogen
infection site between the primary cell wall and the
plasma membrane of a host cell. Papilla contains cell
wall materials (callose and lignin).
Resistance (R) genes: Plant genes involved in recognition
of pathogen avirulence factors. These genes encode
putative receptors of avirulence factors and the majority
of them are leucine-rich repeat proteins and/or kinases.
Resistant plant: A plant that is able to resist pathogen
infection and exhibits no or few disease symptoms. A
plant may be resistant to one pathogen, but susceptible
to another.
Salicylic acid (SA): Salicylic acid, or 2-hydroxybenzoic
acid [C6H4(OH)CO2H], is an endogenous messenger for
activation of multiple plant resistance responses against
microbial pathogens. SA accumulation is a hallmark of
SAR.
Saprophyte: A microbe that does not feed on living plant
tissues or cause disease in any plants. A saprophyte
may be present in or on plants and feed as a secondary
scavenger.
Susceptible plant: A plant that is not able to resist
infection of a pathogen and exhibits disease symptoms.
A plant may be susceptible to one pathogen, but
resistant to another.
Systemic acquired resistance (SAR): A long-lasting,
broad-spectrum resistance induced throughout
otherwise susceptible plants by prior local infection of
necrotizing pathogens or pretreatment of certain
chemical inducers (such as salicylic acid [SA],
benzothiadiazol [BTH], and 2,6-dichloroisonicotinic acid
[INA]). SAR is accompanied by accumulation of SA,
which is required for activation of a set of ‘pathogenesis-
related’ (PR) genes.
Type III secretion: A specialized bacterial protein
secretion process that delivers some bacterial virulence
protein to the host apoplast and others directly into the
host cell cytoplasm or nuclei. This secretion process is
conserved in both plant and mammalian bacterial
pathogens.
Virulent pathogen: A pathogen in a susceptible plant. A
virulent pathogen becomes avirulent when it is in a
resistant plant.
Virulence: A quantitative descriptor of the ability of a
pathogen to colonize a host and cause disease.
Water-soaking: A common disease symptom in bacterial
The Arabidopsis Book 28 of 35
infection. Water-soaking is caused by release of water
and, presumably, nutrients into the apoplast from infected
plant cells. In the case of Pseudomonas syringae infection
of Arabidopsis leaves, the water-soaking symptom
appears first in the infected leaves. The water-soaked
regions will become necrotic eventually. The molecular
basis of water-soaking is not known.
APPENDIX II: A PARTIAL LIST OF EXPERTS AND
THEIR EMAIL ADDRESSES
James Alfano (jalfano2@unl.edu)
Frederick Ausubel (ausubel@frodo.mgh.harvard.edu)
Carol Bender (cbender@okway.okstate.edu)
Andrew Bent (afb@plantpath.wisc.edu)
Jen Boch (boch@genetik.uni-halle.de)
Alan Collmer (arc2@cornell.edu)
Jeff Dangl (dangl@email.unc.edu)
Xinnian Dong (xdong@hercules.acpub.duke.edu)
Jane Glazebrook (jane.glazebrook@syngenta.com)
Murray Grant (m.grant@ic.ac.uk)
Jean Greenberg (jgreenbe@midway.uchicago.edu)
Sheng Yang He (hes@msu.edu)
Roger Innes (rinnes@bio.indiana.edu)
Fumi Katagiri (fumiaki.katagiri@syngenta.com)
Barbara Kunkel (kunkel@biology.wustl.edu)
John McDowell (johnmcd@vt.edu)
Timothy McNellis (mcnellis@psu.edu)
Brian Staskawicz (stask@nature.berkeley.edu)
Allan Shapiro (ashapiro@udel.edu)
Jianmin Zhou (JZHOU@plantpath.ksu.edu)
APPENDIX III: BACTERIAL PATHOGEN INOCULATION
TECHNIQUES
The following is a presentation of several common
methods used for bacterial pathogen inoculation of
Arabidopsis. The first section will briefly describe growth
of Arabidopsis plants, specifically, a special case in which
the plants are grown in pots covered with mesh. The next
section will explain bacterial inoculum preparation,
followed by a presentation of three methods of inoculating
Pseudomonas syringae bacterial pathogens onto
Arabidopsis leaves. The three inoculation methods are:
A. Syringe injection of individual leaves.
B. Dipping or spray inoculation of pots or flats of plants.
C. Vacuum infiltration of plants in screened pots.
These protocols are used in Sheng Yang He’s laboratory.
Growing Arabidopsis Plants for Inoculation:
For syringe injection or spray inoculation, the plants can be
grown by standard methods (without mesh), but if plants are
going to be used for dipping or vacuum infiltration it is
recommended that they be grown in pots with mesh. This
is important for helping contain the soil during inversion in
the inoculum. The soil mix we use is an equal mix of Baccto
high porosity professional plant mix, perlite and vermiculite.
The moist soil mix is mounded into 3-inch square pots and
has a thin layer of fine vermiculite spread over the top of the
soil. This soil mix should rise about 0.5 to 1 inch above the
edge of the pot. The pot is then covered with mesh (we use
plastic window screen), which is held firmly to the surface of
the soil with a rubber band. The pots are placed in flats and
soaked with a fertilizer solution.
Arabidopsis seed is sown in the screened pots and
covered with a plastic dome to maintain high humidity for
efficient germination. If necessary, the flats may be placed
in the cold (4°C) for 2 days and then moved to the growth
chamber. The cold treatment will help to synchronize
germination. The growth chamber conditions are 20°C
and 70-80% relative humidity with 12 hours of fluorescent
light (a light intensity of approximately 100 to 150
µEinsteins/m2/sec). After about 1 week, the seeds will
germinate and emerge on top of the screen. The plastic
domes are then opened slightly for a couple of days and
then removed completely. At this time any excess plants
are removed from the pot (usually 4 to 6 well-distributed
plants are grown in each pot). The plants are watered from
the bottom up (adding water to the flat) once or twice a
week. It is important not to let the soil completely dry out
between watering. At the same time, it is important not to
overwater plants. The plants have fertilizer added during
Figure 10. Arabidopsis grown in pots with mesh. (A) A pot
of four-week-old Arabidopsis plants. (B) A pot of six-week-
old Arabidopsis plants.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 29 of 35
watering about every two weeks, or more often if
necessary.
Plants 4 to 6 weeks old are used for inoculation (at this
point they usually have numerous large leaves but have not
started to flower). Pictures of Col-0 plants grown in
screened pots are shown in Figure 10.
Pseudomonas Inoculum Preparation
1. Bacteria are streaked out from a –80°C glycerol stock
onto a plate of King’s medium B or a low salt Luria Bertani
(LB) medium (10 g/L Tryptone, 5 g/L Yeast Extract and 5
g/L NaCl pH=7.0) with appropriate antibiotics and grown
for 1 or 2 days at 28°C. Many P. syringae strains do not
grow well in a high pH medium. Adjust the medium pH to
pH 7 or slightly lower.
2. Bacteria from the fresh streak are transferred to a
liquid culture with appropriate antibiotics and grown with
shaking at 28°C for 8 to 12 hours, when bacterial culture
should reach mid to late log phase growth (OD600=0.6 to
1.0). (Alternatively, the bacteria can be plated and grown
on solid medium, and then scraped off the plate for use in
preparation of the inoculum.)
3. The bacteria from the liquid culture are harvested. If
the culture overgrows the OD600 estimate of viable bacteria
will not be as accurate because of the increasing number
of dead bacteria and Arabidopsis leaf symptom
development will be more variable.
4. The culture is centrifuged at 2500 x g for 10 minutes
in a swinging bucket rotor to pellet the bacteria.
5. The culture supernatant is poured off and the bacteria
are resuspended in sterile water or 10 mM MgCl2. We
have used both, and water seems to work as well as 10
mM MgCl2.
6. (Optional) The cells can be washed 1 or 2 times in
water (in volumes equal to that used to grow the bacteria)
by repeating steps 4 and 5.
7. The Optical Density (OD) of the bacterial cell
suspension is quantified using a spectrophotometer set at
600 nm.
For Pst DC3000 an OD600=0.2 is approximately 1 x 108
colony-forming units/mL. Injection of dense bacterial
suspensions (~108 cfu/mL) of avirulent bacteria is used to
elicit a confluent hypersensitive response (dry-looking
necrosis) in resistant plants in a relatively short time
(approximately 8 to 12 hours after injection). This is
because most plant cells have direct contact to the
bacteria and undergo the HR with this high density of the
bacteria inoculum. In this way, the HR can be
macroscopically observed. Dense bacterial suspensions
of virulent bacteria cause a slower disease necrosis (at 18
to 24 hours) if injected into leaves. Dense bacterial
suspensions are also used in dipping or spraying
inoculation. In these cases, disease symptoms will
develop within 3 or 4 days in susceptible plants, whereas
no disease symptoms will appear in resistant plants.
A lower level of inoculum (OD600=0.002 of Pst DC3000 is
1 x 106 cfu/mL) is used for syringe or vacuum infiltration.
Avirulent bacteria, when injected or vacuum infiltrated into
a resistant host at 106 cfu/mL, usually produces no
disease symptoms, whereas the virulent bacterial strain
will cause chlorosis and necrosis of the infiltrated tissue of
a susceptible host plant within 3 days.
8. The inoculum is made by calculating the proper
dilution necessary for the desired bacterial concentration
and then diluting that volume of bacteria in sterile water.
Note that a plant’s response to bacteria could vary for
different growth conditions. Even subtle differences, such as
differences in the watering program or airflow around plants
can significantly change the response. The dose of bacteria
may have to be empirically adjusted in each laboratory. For
example, in Fumi Katagiri’s laboratory, typically 2 to 10 times
lower bacterial doses are used for these purposes.
Syringe Injection
Plants are grown by standard techniques and the inoculum
is prepared as described above. Individual leaves can be
infiltrated easily using a syringe. The steps are illustrated
below:
1. A leaf is selected and marked so that it can be
identified later. A blunt-ended permanent marker works
well for this.
2. The leaf is carefully inverted, exposing the abaxial
(under) side. A 1-mL needleless syringe containing a
bacterial suspension is used to pressure-infiltrate the leaf
intracellular spaces. Avoid the vascular system of the leaf
for injection; damage of the midrib will have obvious
detrimental effects on the viability of the leaf tissue (see
Figure 11).
3. Only a small amount of inoculum (approximately 10
µL) will infiltrate the leaf. As this occurs, water-soaking of
the leaf is apparent.
4. The intercellular spaces of the infiltrated leaves are
allowed to dry and then the plants are covered with a plastic
dome to maintain humidity for 2 to 3 days. Leaves that have
been syringe-inoculated with 5 x 105 cfu/mL of Pst DC3000
four days after inoculation are shown in Figure 2.
The Arabidopsis Book 30 of 35
Spray or Dipping Inoculation
The normal infection route for Pseudomonas syringae and
other foliar bacterial pathogens is through wounds or
natural openings such as stomata. Dipping or spraying
bacterial suspensions on Arabidopsis leaves mimics this
natural method of entry into the apoplastic space.
Spray Inoculation:
The plants are grown and the bacterial suspension pre-
pared as previously described.
Plants in pots or flats are sprayed with a bacterial sus-
pension containing 2 to 5 X 108 cfu/mL in water with 0.02
to 0.05% Silwet L-77 (Union Carbide)1. A normal spray
bottle with the nozzle set to spray a fine mist is used.
Continue to spray the bacterial suspension onto leaves
until there is imminent runoff. By this point, the leaf sur-
faces should be coated with the bacterial suspension and
appear evenly wet (Figure 12).
Dipping Inoculation:
Dipping inoculation is much like spray inoculation, it is
simply a different way of coating the leaves with the bac-
terial suspension. Plants grown in pots with mesh are
dipped into a bacterial suspension like that used for spray
inoculation. The inverted pot of plants is fully submerged
in the bacterial suspension for 2 to 3 seconds and then
removed. The leaf surfaces should be evenly coated with
the bacterial suspension.
Following inoculation, the plants are immediately placed
under a plastic dome to maintain high humidity for 2 to 3
days. The high humidity (80 to 90%) supports disease
symptom development. It is important to ensure that the
Figure 11. Syringe infiltration of Arabidopsis leaves. (A) The abaxial (under) side of the Arabidopsis leaf to be syringe-infiltrated.
(B) Placement of the syringe on the right side of the leaf, avoiding the midvein. (C) Gentle infiltration of a portion of the leaf’s
intercellular space. (D) The syringe-infiltrated leaf. Note that the infiltrated area appears water-soaked.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 31 of 35
humidity is not too high (~100%), otherwise the leaf intra-
cellular spaces will become completely saturated, giving
abnormal disease symptom development.
1 Note, Silwet L-77 is a surfactant believed to improve
the access of bacteria to the leaf apoplastic space. The
amount of L-77 necessary in the inoculum (but below
the level of phytotoxicity) may vary depending on the
ecotype/genotype of the plants inoculated and the
conditions in which they are grown. For Pst DC3000
inoculation of Col-0 plants, we typically use 0.05%
Silwet L-77. As with each inoculation technique, the
conditions should be carefully optimized before
experimental use. If L-77 is not used in the bacterial
suspension, the bacterial suspension will bead up into
droplets on the hydrophobic surface of the leaves and
rapidly run off the leaves. This significantly reduces the
reliability of symptom development on any particular
plant or leaf, although some leaves will still develop
disease symptoms without the use of Silwet L-77.
Vacuum Infiltration
1. The inoculum is prepared as described above. Note
the surfactant L-77 Silwet is added to the inoculum at the
level of 0.004% (40 µl/L). The Silwet aids in vacuum
infiltration; without it not all the leaves will be infiltrated.
Note, a relatively large volume of inoculum is needed,
usually several liters; it depends on the container used for
vacuum infiltration and the number of plants to be
infiltrated.
2. The vacuum infiltration apparatus (Figure 13) is
assembled and the refrigerated condensation trap is
turned on.
3. The inoculum is poured into a container (a 1-L glass
beaker is shown), which supports the inverted pot (so that
the whole pot is not submerged) while allowing the plants
to be entirely immersed in the inoculum.
4. The beaker with the plants in the inoculum is placed in
the vacuum chamber and the vacuum pump is turned on.
5. When the vacuum pressure reaches a level of
approximately 20 inches of mercury, it is maintained for 1
minute while the pump continues to pull a vacuum.
The vacuum pressure and the time necessary for
complete infiltration of the leaves without inflicting damage
to the plants may vary for other vacuum systems, but the
optimal settings can be determined by trial and error. After
1 minute, the vacuum pressure gauge reads 22 to 25
inches mercury and bubbles will appear on the surface of
the leaves as well as on the top of the inoculum.
6. After the incubation, the vacuum pressure is rapidly
released by removing the valve stopcock. When the
vacuum pressure returns to zero, the plants can be
removed from the chamber. During this rapid return to
atmospheric pressure the leaves will become infiltrated
with the bacterial suspension. Pictures of steps 3 through
6 are shown in Figure 14.
7. A successful inoculation results in almost all the
leaves being fully infiltrated with the inoculum. The
effectiveness of the vacuum treatment can be easily
assessed by examining the plant leaves. Infiltrated leaves
look darker green (water-soaked) due to the presence of
the bacterial suspension within the leaf intercellular spaces
(see Figure 14 F).
8. If more plants are to be treated, the soil-contaminated
bacterial suspension is discarded and replaced with fresh
inoculum and steps 4 through 7 are repeated.
9. After inoculation, the plants are allowed to dry
completely (for 1 to 3 hours), until the leaves do not look
water-soaked any more. The inoculated plants are then
covered with a plastic dome for 2 to 3 days to maintain
high humidity.
For Col-0 plants inoculated with Pst DC3000 at a dose
of OD600=0.002 Pst DC3000 (106 cfu/mL), the water-
soaked symptom will develop within 2 to 3 days followed
by chlorosis and necrosis of the inoculated tissue
occurring 3 to 4 days post-inoculation (Figure 15).
Figure 12. Spray inoculation of Arabidopsis plants. (A)
Arabidopsis plants before inoculation. (B) The same pot of
plants after spray-inoculation. (C) The spray bottle. (D)
Spraying inoculum onto the plants.
The Arabidopsis Book 32 of 35
APPENDIX IV: BACTERIAL PATHOGEN
ENUMERATION PROCEDURE
The classic phytopathological technique for quantifying
bacterial virulence is an assay measuring bacterial
multiplication within the host tissue. Virulent pathogens
(e.g., Pst DC3000) inoculated at low concentrations (e.g.,
<104 colony-forming units/cm2 leaf tissue, which
approximately corresponds to an inoculation of 1x106
cfu/ml) can colonize the host tissue and in the course of
several days multiply more than 10,000-fold within the
host tissue (to a level of 1 x 108 colony-forming units/cm2
leaf tissue). In contrast, nonpathogenic mutant strains
(e.g., Pst DC3000 hrpH- mutant) or avirulent pathogens
(e.g., Pst DC3000 carrying the avrRpm1 gene) in the same
time course will either not multiply significantly or grow
only 10- to 100-fold within the host tissue (Figure 16). The
massive multiplication of the virulent bacteria correlates
well with symptom development, such that the bacterial
strain attains the maximal population immediately in
advance of significant symptom development, which in the
case of Pst DC3000 infection is characterized by necrotic
lesions surrounded by diffuse chlorosis. The
nonpathogenic strains or avirulent strains do not multiply
to high populations and also do not produce disease
symptoms.
A standard enumeration procedure involves pathogen
inoculation (see Appendix II) followed by assaying
bacterial populations present within host tissues at regular
intervals (usually daily, including the day of inoculation, to
establish the bacterial level immediately following
inoculation). Typically the preferred inoculation techniques
are either syringe injection or vacuum infiltration. From our
experience, these two methods of inoculation produce
more reproducible starting bacterial populations within the
host leaves. Inoculum densities are usually relatively low,
from 1 x 104 to 1 x 106 cfu/mL, to allow the maximum room
for bacterial multiplication to occur within the host tissue.
Plotting log (culturable bacterial number/cm2 leaf tissue)
against time (usually in days) after pathogen inoculation
produces an unfitted curve, commonly known as a growth
curve. This is a standard means of evaluating how well a
bacterial pathogen multiplies in plant tissues. An example
of a growth curve is shown in Figure 16.
Procedure:
1. Leaves are harvested and surface sterilized1 as
follows:
Whole leaves are removed from the host plant and
placed in a 70% ethanol solution for 1 minute. The leaves
are gently mixed in the solution occasionally. The leaves
are then removed, blotted briefly on paper towels and then
rinsed in sterile distilled water for 1 minute. The leaves are
then removed and blotted dry on paper towels. Leaf disks
are excised from leaves with a 0.5 cm2 or smaller cork
Figure 13. The vacuum-infiltration apparatus. The vacuum pump, refrigerated condensation trap, vacuum pressure gauge, bell
jar, and valve with stopcock are indicated by arrows.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 33 of 35
Figure 14. Vacuum infiltration procedure steps 3 through 6. (A) The plants and bacterial suspension before infiltration. (B)
Inverting the pot of Arabidopsis plants in the bacterial suspension. (C) Vacuum infiltration of the plants while in the sealed bell
jar. (D) Release of the vacuum pressure by removal of the valve stopcock. Note that the surface of the bacterial suspension and
the leaf surface are covered with bubbles before the vacuum pressure is released. (E) Removal of the pot of plants from the bac-
terial suspension. (F) Comparison of uninoculated (left) and vacuum-infiltrated plants (right). The vacuum-infiltrated leaves have
inoculum within their intercellular space and appear water-soaked.
The Arabidopsis Book 34 of 35
borer depending on the size of the sample leaves.
Typically, leaf disks from the leaves of 2 or more
independent replicate plants are pooled for a single tissue
sample. Three or more samples are needed for each time
point to generate statistically analyzable data.
2. The leaf disks for a single sample are placed in a 1.5-
mL microfuge tube with 100 µL sterile distilled water.
Steps 1 and 2 are repeated for each sample.
3. The tissue samples are ground with a microfuge tube
plastic pestle, either by hand or, if many samples are
involved by using a small hand-held electric drill. The
samples are thoroughly macerated until pieces of intact
leaf tissue are no longer visible.
4. The pestle is rinsed with 900 µL of water, with the
rinse being collected in the original sample tube such that
the sample is now in a volume of approximately 1mL.
5. Steps 3 and 4 are repeated for all the samples.
6. Following grinding of the tissue, the samples are
thoroughly vortexed to evenly distribute the bacteria within
the water/tissue sample. A 100-µl sample is removed and
diluted in 900 µl sterile distilled water. A serial 1:10 dilution
series is created for each sample by repeating this
process. The number of serial dilutions necessary to get
countable colonies must be determined for each sample
empirically, but dilutions to 10-7 are usually sufficient for
any bacterial strain.
7. The samples are plated on the appropriate medium
(e.g., King’s medium B) supplemented with the necessary
antibiotics to select for the inoculated bacterial strain.
Plating can be done in the traditional way (100 µL of a
single sample is spread on a single plate) or several 10 µL
aliquots of the 1:10 serial dilutions can be spotted on to a
single plate and allowed to dry onto the surface.
8. The plates are placed at 28°C for approximately 2
days and then the colony-forming units for each dilution of
each sample are counted. A plating of a typical sample
dilution series is shown in Figure 17.
Figure 15. Disease symptoms following vacuum infiltration.
Plants 4 days after inoculation with different densities of Pst
DC3000 are shown. Plants vacuum infiltrated with 1 x 104
cfu/mL (A) 1 x 105 cfu/mL (B) 1 x 106 cfu/mL (C) and 1 x 107
cfu/mL (D).
Figure 16. Multiplication of P. syringae pv. tomato DC3000
strains in Arabidopsis leaves. Leaves were inoculated with 1
x 105 cfu/mL of bacteria and in planta bacterial populations
were determined daily. Multiplication of P. syringae pv. toma-
to DC3000 (virulent), DC3000/avrRpm1 (avirulent), and the
DC3000 hrpH- mutant (nonpathogenic), in Arabidopsis
Columbia leaves is plotted on a log scale. The error bars
indicate the standard deviation within the 3 replicate samples
for each treatment.
Figure 17. Determination of the bacterial population in inoc-
ulated leaf tissue. (A) A square plate containing agar medi-
um with the appropriate antibiotics was spotted six times
with 10 µL of six 10-fold dilutions of a homogenate of Pst
DC3000-inoculated Arabidopsis leaves. The plate was incu-
bated at 28°C for 2 days. (B) A close-up of a portion of the
plate from (A) is shown. The dilution factor of each sample
is indicated. Countable colonies are visible in spots from
sample dilutions of 10-4 and/or 10-5.
The Arabidopsis Thaliana-Pseudomonas Syringae Interaction 35 of 35
For the 10-µL spotting technique, a single spot should
be used for estimating the bacterial population only if it has
>10 and < ~70 colonies (or whatever is reliably countable)
present in the spotted sample dilution. The population
present within the tissue is calculated based on the dilution
factor divided by the amount of tissue present in each
sample.
1Note, leaf surface sterilization is optional, but
recommended. It removes bacteria present on the
surface of the leaf (those present from the inoculation as
well as any initially present epiphytic populations). Thus,
the populations assayed are those bacteria present
within the apoplastic space (and thus protected from
surface sterilization). These bacteria within the
apoplastic space and not those on the leaf are
responsible for disease development. Obviously, leaf
surface sterilization cannot be used on the leaf samples
from spray or dip inoculated plants from day 0, since
immediately following inoculation the inoculated
bacteria are present on the surface and susceptible to
the surface sterilization procedure.
